Full text of "Biodiversity journal"

See other formats

Oiomoe/eo monachus Gray, 1365 - Socotra island [Yemen)

FOR NATURALISTIC RESEARCH
AND ENVIRONMENTAL STUDIES

i K'U f ' . T,j Tit

lLi-‘ E > il/ i.u */ iE i -

ti f$ u W A t 1

f t/ g/®" f jf Jy fi'l* fiy

JUNE 2011, 2 (2): 51-104

www btodiversityjournaL com

ISSN 2039-0394 (Print Edition)
ISSN 2039-0408 (Online Edition)

Its support or

Cover: An adult male of Chamaeleo monachus,
Socotra Island, Wadi Ayheft, 11.2009. 1 ) idem.
2) Pristurus sokotranus, Socotra Island, Wadi
Da’Arho, 11.2009. 3) P. samhaensis, Darsa
Island, 11.2009. (photos by Pietro Lo Cascio
and Flavia Grita)

REPTILES OF SOCOTRA. Chamaeleo monachus was described by the herpetologist John E. Gray in
1865, who indicated “Madagascar” as type-locality for the new species. However, the specimen studied by
Gray came from Socotra, where chameleons were perhaps collected as pets by Arab sailors and successively
sold to Britishs travellers with erroneous information about their provenience, but only after the first
scientific expedition carried out on the island by the botanist Isaac Balfour in 1880 it was possible to
determine its true origin. C. monachus now is appropriately known as one of the several endemic reptile
species of the Socotra Archipelago (Yemen), where it is the only representative of the family
Chamaeleonidae and where it is exclusively distributed on the main island. The archipelago is located about
380 kilometers south-east off the Yemen coast and 100 km east from Cape Guardafui (Somalia), and
includes four islands, whose size ranges from 3,625 (Socotra) to 12 km2 (Darsa). Socotra’s levels of
endemism confer global significance, both in plants and animals; the main island is a fragment of
Gondwana, fistly isolated in the Indian Ocean during Eocene-0 ligocene (34-41 million year's ago), and
palaeogeographic data indicate that all the islands have been definitively isolated from Africa about six
million years ago. Reptiles is undoubtly one of the most important and significant groups among the
vertebrate faunas of these islands in terms of biological diversity. According to the recently updated
checklist given by Razzetti et al. (2011, in Zootaxa 2826: 1-44), the Socotra Archipelago harbours 30
species belonging to 12 different genera, some of which are strictly endemic of the islands: the gekkonid
Haemodracon Bauer et al., 1997, and two snake monotypic genera, the colubrid Hemerophis Schatti &
Utiger, 2001, and the lamprophiid Ditypophis Gunther, 1881. Except for the bizarre story of the homeland
of the Socotran chameleon, the first knowledge on the herpetofauna of the archipelago is mainly due to the
zoological expedition led by the British naturalists Henry O. Forbes and William R. Ogilvie-Grant in the
late 19th century, but investigations on taxonomy and distribution of several species are still in progress, as
evidenced by the recent description of the gekkonid Hemidactylus inintellectus Sindaco et al., 2009, as well
as by the fact that seven other species have been described during the last three decades. The endemicity
rate among reptiles is very high and 90% of occurring species are exclusive of one or more islands;
moreover, some of which are also strictly confined on very small areas: a significant example is given by
Hemidactylus dracaenacolus Rosier & Wranik, 1999, so far known only from few localities of the Diksam
Plateau at Socotra where it inhabits barks and trunks of the renowned dragon blood trees, the relictual
endemic Dracaena cinnabari. Most part of the occurring reptiles (18) belong to the family Gekkonidae and
some genera, such as the diurnal Semaphore geckos Pristurus Ruppell, 1835 or the nocturnal Hemidactylus
Oken, 1817, are interested by remarkable processes of adaptive radiation: both include 7 endemic species
(the latter, also, comprises 3 species introduced on the islands). In particular, Socotra and its satellite islands
harbour one third of the 20 recognised species of Pristurus, a genus distributed in Arabia and north-eastern
Africa with an isolate in Mauritania. These geckos are mainly heliothermic ground- or rock-climbers, but a
small number of taxa is known as free dwelling; among the Socotran representatives, P obsti Rosier &
Wranik, 1999, originally recorded for the mangroves of Shu’ab Gulf, and the closely related P guichardi
Arnold, 1986, known for the mountains of Hajhir Massif, are purely arboreal, while the most common and
widespread P. sokotranus Parker, 1938, as well as P. insignis Blanford, 1881 and P. insignoides Arnold,
1986, are generally associated to rocks and cliffs. P abdelkuri Arnold, 1986 is endemic of the westernmost
island Abd al-Kuri, but some introduced populations of this species have been recently recorded at Socotra.
Finally, P. samhaensis Rosier & Wranik, 1999 replaces P. sokotranus in the small islands of Samha and
Darsa, also called “The Brothers”.

Pietro Lo Cascio, Associazione Nesos, via Vittorio Emanuele 24 - 98055 Lipari (ME) ITALY - plocascio@nesos.org.

Biodiversity Journal, 2011, 2 (2): 53-58

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina
State, Southern Brazil region: check list and regional spatial distribution

A. Ignacio Agudo-Padron

Project “Avulsos Malacologicos”, Caixa Postal (PO. Box) 010, 88010-970, Centro, Florianopolis, Santa Catarina, SC, Brasil;
ignacioagudo@gmail.com; http://www.malacologia.com.br

ABSTRACT A total of twenty-one exotic mollusc taxa were assessed for Santa Catarina State (SC), fifteen Gastropoda and
six Bivalvia (twelve terrestrial, five limnic/freshwater - three gastropods and two bivalves, and four marine
bivalves). Of these, fourteen are confirmed as invasive species (nine terrestrial, three limnic/freshwater, and
two marine).

KEY WORDS Biodiversity, Continental mollusc fauna, Exotic and invasive species, Santa Catarina State, Southern Brazil region

Received 18.02.2011; accepted 12.04.2011; printed 30.06.2011

INTRODUCTION

To date, the presence of a total of twenty-one (21)
mollusc species, under the designation of “exotic
introduced species” (48% of the total acknowledged
in Brazil), was confirmed for the territory of Santa
Catarina State (SC), a small central state within the
South Brazil region - of these species, fifteen were
Gastropoda and six Bivalvia (twelve terrestrial, five
limnic/freshwater - three gastropods and two
bivalves - four marine bivalves). The list also
includes the slug Pallifera sp., a species still within
the taxonomic status confirmation process, with
descriptions of the species to be found in Agudo &
Bleicker (2006), Agudo-Padron (2008a) and Agudo-
Padron & Lenhard (2010). Of these species, fourteen
are identified as invading forms in Santa Catarina
State (ten Gastropoda - nine terrestrial and one
freshwater - and four Bivalves - two freshwater and
two marine). In the present work, the current
regional knowledge situation of these molluscs is
briefly revised, including basic maps covering the
distribution of such species in the state.

ANALYSIS OF THE CONTEMPLATED SITUATION

The current survey started in November 2009
and included the organization of official seminars
(Oficial State Program for Listing and Control of

Invasive Exotic Species), organized and driven by
the Official Santa Catarina State Environment
Foundation (Fundagao do Meio Ambiente -
FATMA) jointly with the Horns Institute of
Development and Environmental Conservation
(Instituto Horns de Desenvolvimento e
Conservacao Ambiental). The main goal of such
seminars was the formulation of a “Official State
Fist of Species” (Agudo-Padron 2011a, b).

Of the two participant researchers in the enacted
Mollusc Group, only one worked specifically with
continental species. It is worth highlighting that the
Asian golden mussel, Limnoperna fortunei
(Dunker, 1857), a highly invasive species which is
still localized within Santa Catarina State (Agudo-
Padron 2007, 2008b; Agudo-Padron & Fenhard
2010), received particular attention within such
seminars. On another note, the cultivated mussel
Perna perna (Finnaeus, 1758) was removed from
the list of invasive species for the State since, after
an extensive analysis and technical discussion, it
was concluded that the species is actually being
considered a native one in the State and in the
whole of Brazil (Magalhaes et al., 2007; Schaefer et
al., 2009).

The following is a list of introduced and invading
molluscs in Santa Catarina State (SC) along with
inter-relationships between such species, based
mainly on the taxonomic contributions of Simone
(2006) and Thome et al. (2006, 2007) (Figs 1-17).

A. I. Agudo-Padron

^ A

Arte: Boletim AM

Rumina decollata

Vertigo ovata

Fig-1

Fig-2

Arte: Boletirn AM

Pallifera sp.

Lehmannia valentiana

Fig-3

Fig-4

• •

Baia *
Norte

Baia

Sul

Atlantic

Ocean

• •

Limacus flavus

Limax maximus

Fig-5

Fig-6

• •

Arte: Boletim AM

• •

Baia *
Norte

Baia

Sul

Atlantic

Ocean

• •

Deroceras laeve

Fig-7

Figures 1-8. Regional spatial distribution of exotic molluscs
in Santa Catarina (1).

••

1 *

• •

Baia *
Norte

Baia

Sul

Atlantic

Ocean

• •

Achatina fulica

Fig-8

| | Atlantic rainforest

| 1 Arauncaria forest and Capos

[=□ Subtropical forest of the Uruguay River

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina State, Southern Brazil region: check list and regional spatial distribution

: • •

• ••

Baia

Norte

Baia

Sul

• Atlantic
Ocean

• •

Arte: Boletim AM

Bradybaena similaris

Fig-9

Arte: Boletim AM

Helix (Cornu) aspersa

Fig. 10

Arte: Boletim AM

Paralaoma servilis

Arte: Boletim AM

Zonitoides arboreus

Fig. 11

Fig.12

Arte: Boletim AM

Pomacea paludosa

Arte: Boletim AM

Melanoides tuberculatus

Fig.13

Fig. 14

•

Arte: Boletim AM

Aplexa rivalis

Corbicula fluminea

Corbicula largillierti

Fig.15

Fig. 16

Fig. 17

Atlantic rainforest

Figures 9-17. Regional spatial distribution of exotic molluscs
in Santa Catarina (2).

Arauncaria forest and Capos
Subtropical forest of the Uruguay River

A.I. Agudo-Padron

RESULTS

TERRESTRIAL TAXA

Twelve recognized species (26% of the total
confirmed in Brazil). Of these, nine are specific
invading forms.

Class GASTROPODA - Pulmonata

Family SUBULINIDAE Thiele, 1931
Genus Rumina Risso, 1826
Rumina decollate! (Linnaeus, 1758)

Family VERTIGINIDAE Fitzinger, 1833
Genus Vertigo Muller, 1774
Vertigo ovata Say, 1822

Family PHILOMYCIDAE Keferstein, 1866
Genus Pallifera Morse, 1864
Pallifera sp. (Fig. 18)

INVADER

Family LIMACIDAE Rafinesque, 1815
Genus Limacus Lehmann, 1864
Limacus flavus (Linnaeus, 1758) (Fig. 19)
INVADER

Genus Umax Linnaeus, 1758

Limax maximus Linnaeus, 1758 (Fig. 20)

INVADER

Genus Lehmannia Heynemann, 1863
Lehmannia valentiana Ferussac, 1822
INVADER

Family AGRIOLIMACIDAE Wagner, 1935
Genus Deroceras Rafinesque, 1820
Deroceras laeve (Muller, 1774)

INVADER

Family ACHATINIDAE Swainson, 1840
Genus Achatina Lamarck, 1799
Achatina {Lis s achatina) fulica (Bowdich, 1822)
INVADER

Family BRAD YBAENIDAE Pilsbry, 1934
Genus Bradybaena Beck, 1837
Bradybaena similaris (Ferussac, 1821) (Fig. 21)
INVADER

Family HELICIDAE Rafinesque, 1815

Genus Helix Linnaeus, 1758

Helix {Cornu) aspersus (Muller, 1774) (Fig. 22)

INVADER

Family PUNCTIDAE Morse, 1864
Genus Paralaoma Iredale, 1913
Paralaoma servilis (Shuttleworth, 1852)

Family GASTRODONTIDAE Tiyon, 1866
Genus Zonitoides Lehmann, 1862
Zonitoides arboreus (Say, 1817)

INVADER

FRESHWATER/ LIMNIC TAXA

Five recognized species (12% of the total
confirmed in Brazil). Of this, three are specific
invading forms.

Class GASTROPODA

Caenogastropoda

Family AMPULLARIIDAE Gray, 1824
Genus Pomacea Perry, 1811
Pomacea paludosa (Say, 1829)

Family THLARIDAE Troschel, 1857
Genus Melanoides Olivier, 1804
Melanoides tuberculatus (Muller, 1774)

INVADER

Pulmonata

Family PH YSIDAE Fitzinger, 1833
Genus Aplexa Fleming, 1820
Aplexa rivalis (Maton & Rackett, 1807)

Class BIVALVIA - Veneroida

Family CORBICULIDAE Gray, 1847
Genus Corbicula Megerle von Miihlfeld, 1811
Corbicula fluminea (Muller, 1774) (Fig. 23)
INVADER

Corbicula largillierti (Philippi, 1 844)

INVADER

MARINE TAXA

Four recognized species (9% of the total
confirmed in Brazil). Of these, two are specific
invading forms.

Class BIVALVIA
Ostreoida

Family OSTREIDAE Rafinesque, 1815
Genus Crassostrea Sacco, 1897
Crassostrea gigas (Thumberg, 1795)

Crassostrea virginica (Gmelin, 1791)

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina State, Southern Brazil region: check list and regional spatial distribution

Fig. 18

Fig. 19

Fig.20

Fig. "21

Fig-22

Fig. 23

Figure 18. Invasive exotic slugs PaUifera sp.

Figure 19. Limacus flavus.

Figure 20. Umax maximus (photo P. Lenhard).
Figure 21. Bradybaena similaris (photo P. Lenhard).
Figure 22. Cornu aspersum (photo P. Lenhard).
Figure 23. Corbicula fluminea.

A.I. Agudo-Padron

Pterioida

Family ISOGNOMONIDAE Woodring, 1925
Genus Isognomon Lightfoot, 1786
Isognomon bicolor (C. B. Adams, 1845)
INVADER

Mytiloida

Family MYTILIDAE Rafinesque, 1815
Genus Lithophaga Roding, 1798
Subgenus Myoforceps P. Fischer, 1886
Lithophaga ( Myoforceps ) aristatus (Dillwyn, 1817)
INVADER

DISCUSSION AND CONCLUSIONS

The official lists of alien and invasive mollusc
species for Santa Catarina State compiled by
regional environment institutions (CONSEMA
2010) overlook or give scant importance to the
species listed in this manuscript, listing only a total
number of six related species, five of them being
recognized as “invasive forms” in the State (two
terrestrial = Achatina fulica , Helix aspersa\ three
freshwater/limnic = Melanoides tuberculatus,
Corbicula fluminea, Corbicula largillierti; and one
marine = Crassostrea gigas ).

It is hoped that soon this situation is properly
reviewed, corrected and updated.

ACKOWLEDGEMENTS

Special very thanks to Dra. Silvia R. Sziller,
executive director and researcher of the “Instituto
Horns de Desenvolvimento e Conservagao
Ambiental” (Florianopolis, SC) and Biologist MsC.
Beloni Terezinha Pauli Marterer, Oficial researcher
of the “Fundagao do Meio Ambiente - FATMA”
(Florianopolis, SC) for their timely help with
informations, bibliographical support, critical
observations/ discussion and suggestions.

REFERENCES

Agudo A.I. & Bleicker M.S., 2006. Moluscos exoticos no
Estado de Santa Catarina. Informativo SBMa, 37: 6-8.
Agudo-Padron A.I., 2007. Diagnostico sobre a potencial
ocorrencia do mexilhao-dourado asiatico, Limnoperna

fortunei (Dunker, 1857), no Estado de Santa Catarina,
Brasil. Informativo SBMa, 38: 4-5.

Agudo-Padron A.I., 2008a. Listagem sistematica dos moluscos
continental ocorrentes no Estado de Santa Catarina,
Brasil. Comunicaciones de la Sociedad Malacologica del
Uruguay, 9: 147-179. Available online at: http://redalyc.
uaemex.mx/redalyc/pdf/524/52412049003.pdf

Agudo-Padron A.I., 2008b. Vulnerabilidade da rede
hidrografica do Estado de Santa Catarina, SC, ante o
avango invasor do mexilhao-dourado, Limnoperna
fortunei (Dunker, 1857). Revista Discente Expressoes
Geograficas, 4: 75-103. Available online at:

http://www.geograficas.cfh.ufsc.br/arquivo/ed04/artigo04.pdf

Agudo-Padron A.I. , 2011a. Mollusc fauna of Santa Catarina
State, Central Southern Brasil: current state of knowledge.
Tentacle, 19: 22-24. Available online at: http://www.hawaii.
edu/cowielab/tentacle/Tentacle_19.pdf

Agudo-Padron A.I., 2011b. Mollusca and environmental
conservation in Santa Catarina State (SC, Southern Brazil):
current situation. Biodiversity Journal, 2: 3-8.

Agudo-Padron A.I. & Lenhard P., 2010. Introduced and
invasive molluscs in Brazil: an brief overview. Tentacle,
18: 37-41. Available online at: http://www. hawaii.
edu/co wielab/tentacle/Tentacle_ 1 8 .pdf

CONSEMA - Conselho Estadual do Meio Ambiente. 2010.
Resolucao CONSEMA no. 11, de 17 de Dezembro de
2010. Reconhece a Lista Oficial de Especies Exoticas
Invasoras no Estado de Santa Catarina e da outras
providencias. Florianopolis, SC: SDS/ CONSEMA.
Available online at: http://www.institutohorus.org.
br/down I oad/marcosjegai s/Resolugao_CON S EM A_SC_
ll_2010.pdf

Magalhaes A.R.M., Schaefer A.L.C. & Fossari T., 2007.
Mexilhao Perna perna (Linnaeus, 1758): nativo sim do
Brasil. Rio de Janeiro, RJ: Resumos XX Encontro
Brasileiro de Malacologia, Biogeografia: 237.

Schaefer A.L.C., Magalhaes A.R.M. & Fossari T.D., 2009.
Evidencias da presenga do mexilhao Perna perna em
Sambaquis pre-coloniais brasileiros. Rio de Janeiro, RJ:
Resumos XXI Encontro Brasileiro de Malacologia,
Arqueologia: 432.

Simone L.R.L., 2006. Land and freshwater molluscs of Brazil.
Sao Paulo, FAPESP, 390 pp.

Thome J.W., Gomes S.R. & Picango J.B., 2006. Guia ilustrado:
Os caracois e as lesmas dos nossos bosques e jardins.
Uniao Sul-Americana de Estudos da Biodiversidade -
USEB, Pelotas, 124 pp.

Thome J.W., Arrada J.O. & Silva L.F. da, 2007. Moluscos
terrestres no Cone Meridional da America do Sul,
diversidade e distribuigao. Ciencia & Ambiente, Ciencia &
Ambiente, Fauna Neotropical Austral, 35: 9-28.

Biodiversity Journal, 2011, 2 (2): 59-66

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda
et Bivalvia) of Santa Catarina State, Southern Brazil: check list and
evaluation of regional threats

A. Ignacio Agudo-Padron

Project “Avulsos Malacologicos”, Caixa Postal (PO. Box) 010, 88010-970, Centro, Florianopolis, Santa Catarina, SC, Brasil;
ignacioagudo@gmail.com; http://www.malacologia.com.br

ABSTRACT A total of nineteen continental native mollusc species are confirmed for the Santa Catarina State (SC)
(organized in ten Genera and seven Families), one aquatic Prosobranchia/Caenogastropoda (Ampullariidae),
six Pulmonata terrestrial gastropods (one Ellobiidae, three Megalobulimidae and two micro-snails -
Charopidae and Streptaxidae) and twelve freshwater mussels (eight Mycetopodidae and four Hyriidae). These
species are designated by the International Union for Conservation of the Nature - IUCN as follows: seven as
"Vulnerable", six "In Danger" and six “Without Category Established”. The general regional threats that these
species are subjected to are briefly analyzed.

KEY WORDS Biodiversity, Continental mollusc fauna, Threatened species, Santa Catarina State, Southern Brazil region

Received 18.02.2011; accepted 12.04.2011; printed 30.06.2011

INTRODUCTION

In spite of prodigious scientific and
technological progress in recent years, in
throughout Brazil and other Neotropical
countries, significant difficulties in evaluating
the threats impinging on continental-terrestrial
and freshwater-molluscs species are constantly
being faced by the scientific community,
especially in the geo-political territory of Santa
Catarina State (SC), the smallest space portion of
the Southern Brazil mosaic (Agudo & Bleicker,
2006a; Agudo-Padron, 2006; Agudo, 2007a;
Agudo-Padron, 2007a, 2008a, 2009a, b; Agudo-
Padron & Bleicker, 2009). This state of affairs is
mainly due to the lack of solid population data
and to the small amount of resident limnologists
in this State.

Nowadays, the Santa Catarina State
authorities govern in this territory nine State
Ecological Units of Conservation - six belonging
to the category “Park”, where access to the
public is permitted in most areas, and three
belonging to the category “Reserve”, where

access is quite restricted and permitted only to
researchers; this besides four “National
Ecological Parks” within the jurisdiction of the
same State.

However, do such protected areas truly result
in effective conservation of our known
continental malacological species and of species
which to date have yet to be described?

As previously noticed by local limnologists
(Moraes, 2006), all of the Brazilian native
mollusc species are in imminent threat of
extinction, besides forms that are still awaiting
discovery. Considering the rapid rate of
anthropogenic environmental degradation, it can
be hypothesized that a number of such species
have gone extinct before they were at least
recorded and described scientifically (Simone,
2006).

Besides the environmental degradation
(through deforestation for agricultural ends
and/or mining exploration, pollution of the river
basins with discharges of organic and inorganic
pollutants, indiscriminate application of
agricultural poisons and chemical fertilizers,

A. I. Agudo-Padron

proliferation of the construction of hydroelectric
mills, invasions of natural spaces by town
planning enterprises), the Brazilian terrestrial
mollusc species face stiff competition by
invading forms, that are also responsible for
serious sanitary and agronomic problems, among
others (Agudo, 2007b; Agudo & Bleicker 2006b;
Agudo-Padron 2006, 2007a, b, 2008b, c, d;
Agudo-Padron & Lenhard, 2010). Brought to
Brazil willfully for a variety of purposes, or even
accidentally, those exotic species are alien to the
local ecosystem and for this reason they don’t
possess natural predators, resulting in an
uncontrolled growth of the population, that,
consequently, smothers and even obliterates
native species through the usurpation of their
niches (Simone, 2002).

That scenario is worsened by the absence of
any awareness on the conservation status of these
animals, which are generally not considered
charismatic enough so as to warrant the
declaration of protected natural areas - the
molluscs have a very smaller appeal to the
population than megafaunal species, in spite of
being fundamental for the ecological balance of
ecosystems (Moraes, 2006) (Figs 1-11).

During the course of this study, we also had the
opportunity to document personally the change in
fortunes of some iconic terrestrial mollusc species
- for instance the native giant snail Megalobulimus
gummatus (Hidalgo, 1870) (Fig. 2), found mainly
in the valley of the Uruguay river basin. Abundant
previously at the same location, today it results
difficult to track down in the local environment, as
a result of the increase in regional agricultural
activities (application of pesticides, mainly);
meanwhile invading exotic species, such as the
slug Pallifera sp. (Fig. 1), proliferate and colonise
new areas.

In other cases (very rare), native species resist
and adapt to the anthropological conditions
imposed in their natural environment when this
is invaded becoming themselves, in turn,
agricultural pests in small vegetable cultures. An
example of this situation is presented by the case
of the giant native snail Megalobulimus oblongus
(Muller, 1774) (Fig. 3), in sandbanks of the
“Enseada do Brito”, Palhoga Municipal District
of the Great Florianopolis, a traditional village of
artisanal fishermen located in the proximities of
the “Serra do Tabuleiro Ecological State Park”
(Agudo-Padron & Bleicker, 2009).

Table 1. Santa Catarina State, SC, central portion of the Southern Brazilian country (on the left), and regional geopolitical division showing
physical, socioeconomic and environmental (phytogeographical) characteristics (on the right). Santa Catarina lies between latitudes 25° and
30° S and longitudes 48° and 54° W, extends 377 km from North to South and 547 km from East to West at its most distant points, and has an
area of 95,985 km 2 , which includes 502 km 2 of rivers and lakes. The state constitutes only 1.13% of the total area of Brazil and is divided
geographically into three large parts: the Atlantic Coastal Plains, with several rivers that discharge into the Atlantic Ocean, and two
independent great river basin systems that irrigate the land in the central and western highlands, the Iguazu and the Uruguay.

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

Fig-1

Fig.4 Fig.5

Figure 1. Invasive exotic Asian slugs PaUifera sp.

Figure 2. Native giant snail Megalobulimus gummatus, 108 mm.

Figure 3. Native giant snail Megalobulimus oblongus, 70 mm (photos: P. Lenhard).
Figure 4. Native giant snail Megalobulimus grandis, 130 mm (photo: G. Woehl Jr.).
Figure 5. Native snails Megalobulimus proclivis, 86 mm.

A. I. Agudo-Padron

Curious situation comes with the involvement
of the giant freshwater native bivalve
Anodontites trapesialis (Lamarck, 1819) in the
Northern region of the State (Joinville Municipal
District) and other Brazilian localities out of the
State, whose parasitic larvae type “Lasidium” are
undesirable and harmful pests in enterprises fish
farmers (Agudo, 2005, 2008).

According to Mansur et al. (2003) and
Mansur (2008), it just is not enough to place the
native species in lists of those threatened by
extinction: it is necessary to know our native
fauna from the taxonomic, morphologic and
ecological point of view so as to be able to
propose handling and management strategies.

As previously noted, an inefficient
administration and man’s growing need for water
are bringing freshwater ecosystems to the
collapse, making freshwater species the most
threatened of the planet.

The molluscs that live in rivers and lakes are
the most threatened of the Earth, due to the
collapse of aquatic ecosystems mediated by the
construction of dams and through the incessant
siphoning off of water for agriculture and other
purposes. The rates of extinction of species in
freshwater environments are from four to six
times higher than in marine or terrestrial habitats.
Endemic species, such as the small aquatic snail
Potamolithus catharinae Pilsbry, 1911,
representative of the Family Hydrobiidae (Silva
& Veitenheimer-Mendes, 2004), and the tiny
freshwater limpets Burnupia ingae Lanzer, 1991
and Ferrissia gentilis Lanzer, 1991 (Family
Ancylidae), are particularly vulnerable to human
alterations of their environment (Agudo-Padron,
2011a, b).

The freshwater bivalve molluscs are
particularly sensitive to trampling, to organic and
chemical pollution, and other forms of
degradation of the environment. They present
relatively slow growth rates and they don’t
usually occupy disturbed environments.
Endemic species exist for each basin and many
of these are very restricted spatially and present
high rates of extinction due to the countless
environmental alterations provoked recently by
human settlement.

In the present work, the current regional
knowledge situation of these mollusc species is
revised, including IUCN general status and other
information, to promote their effective conservation.

RESULTS

CURRENT SITUATION

Class GASTROPODA

Subclass PROSOBRANCHIA/CAENOGASTRO-
PODA

Family AMPULLARIIDAE

Pomacea sordida Swainson, 1823
Category IUCN: without category established

Included in the “Lista das Especies da Fauna
Ameacadas de Extincao no Estado do Rio de Janeiro
- RJ” (1997), regional category “in danger”.

Subclass PULMONATA
Family ELLOBIIDAE

Melampus coffeus (Linnaeus, 1758)

Category IUCN: without category established

Reported in the “Lista das Especies da Fauna
Ameaqadas de Extingao no Estado do Rio de
Janeiro - RJ” (1997), regional category
“Vulnerable”. Species considered a “marine form
with wide ecological occurrence”.

Family MEGALOBULIMIDAE

Megalobulimus grandis (Martens, 1885) (Fig. 4)
Category IUCN: in danger

Megalobulimus proclivis (Martens, 1888) (Fig. 5)
Category IUCN: in danger

Megalobulimus oblongus (Muller, 1774)
Category IUCN: without category established

Recently included in the “Lista de Especies da
Flora e da Fauna Ameaqadas no Estado do Para -
PA” (2007), regional category “in danger”.

Family CHAROPIDAE

Rotadiscus schuppi (Suter, 1900)

Category IUCN: in danger
Family STREPTAXIDAE

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

Fig-7

Fig-9

Fig. 6

Fig. 8

Fig. 10

Fig. 11

Figure 6. Native freshwater mussels Anodontites patagonicus, 70 mm (photo P. Lenhard).

Figure 7. Native freshwater mussel Anodontites trapesialis, 75 mm (photo P. Lenhard).

Figure 8. Native freshwater mussel Leila blainvilleana, 120 mm (photo P. Lenhard).

Figure 9. Native freshwater mussel Mycetopoda legumen, 85 mm (photo P. Lenhard).

Figures 10-11. Regional variations of the native freshwater mussel Rhipidodonta charruana, 30-35 mm (photo P. Lenhard / A.I. Agudo-Padron).

A. I. Agudo-Padron

Rectartemon depressus (Heynemann, 1868)
Category IUCN: without category established

Recently included in the “Livro Vermelho da Fauna
Brasileira Ameagada de Extingao” (2003-2004).
Class BIVALVIA

Order UNIONOIDA

Family MYCETOPODIDAE

Anodontites elongatus (Swainson, 1823)
Category IUCN: without category established

Recently included in the “Livro Vermelho da
Fauna Brasileira Ameagada de Extingao” (2003-
2004).

Anodontites ferrarisi (d’Orbigny, 1835)

Category IUCN: in danger

Anodontites patagonicus (Lamarck, 1819) (Fig. 6)
Category IUCN: in danger

Anodontites tenebricosus (Lea, 1834)

Category IUCN: vulnerable

Anodontites trapesialis (Lamarck, 1819) (Fig. 7)
Category IUCN: vulnerable

Leila blainvilleana (Lea, 1835) (Fig. 8)

Category IUCN: in danger

Mycetopoda legumen (Martens, 1888) (Fig. 9)
Category IUCN: vulnerable

Mycetopoda siliquosa (Spix, 1827)

Category IUCN: vulnerable

Family HYRIIDAE

Diplodon expansus (Kuster, 1856)

Category IUCN: vulnerable

Diplodon multistriatus (Lea, 1834)

Category IUCN: vulnerable

Diplodon rhuacoicus (d’Orbigny, 1835)
Category IUCN: without category established
Recently included in the “Livro Vermelho da Fauna
Brasileira Ameagada de Extingao” (2003-2004).

Rhipidodonta charruana (d’Orbigny, 1835) (Fig. 10)
Category IUCN: vulnerable

Reported in the Brazilian lists (MMA, 2004;
Agudo-Padron, 2009c) under the taxonomic
synonymy Diplodon martensi (Ihering, 1893) -
see Simone (2006).

CONCLUSIONS

The public seminar entitled “IV Forum de
Discussao sobre a Fauna ameagada no Estado de
Santa Catarina” and held in March 2010
concluded that the species considered in this
study appear visibly undervalued in the Official
listing compiled by regional environment
institutions (IGNIS, 2010), with only a total
listing of four related marine species (two
bivalves = Crassostrea brasiliana, Euvola
ziczac; and two gastropods = Hastula cinerea,
Olivancillaria contortuplicata ).

It is hoped that soon this situation is properly
reviewed, corrected and updated.

ACKOWLEDGEMENTS

I am also very obliged to P. Lenhard and G.
Woehl Jr. for the photos.

REFERENCES

Agudo A.I., 2005. Praga de bivalves limnicos em acudes. Sao
Paulo, SP: Conquiliologistas do Brasil - CdB. Available
online at: http://www.conchasbrasil.org.br/materias/
pragas/limnicos.asp

Agudo A.I., 2007a. Continental land and freshwater molluscs
in Santa Catarina State, Southern Brasil: a general review

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

of current knowledge. Tentacle, 15: 11-14. Available
online at: http://www.hawaii.edu/cowielab/tentacle/
tentacle_15.pdf

Agudo A.I., 2007b. Moluscos na condigao de Pragas no
Brasil. Sao Paulo, SP: Conquiliologistas do Brasil - CdB.
Available online at: http://www.conchasbrasil.org.br/
materias/pragas/visaogeral/de fault. asp
Agudo A.I., 2008. Manejo e controle de Pragas de bivalves
“naiade” em acudes e viveiros piscicultores. Sao Paulo,
SP: Conquiliologistas do Brasil - CdB. Available online at:
http://www.conchasbrasil.org.br/materias/pragas/manejoe
controle/default.asp

Agudo A.I. & Bleicker M.S., 2006a. First general inventory of
the malacological fauna of Santa Catarina State, Southern
Brazil. Tentacle, 14: 8-10. Available online at:
http ://www.hawaii.edu/cowielab/tentacle/tentacle_ 1 4.pdf
Agudo A.I. & Bleicker M.S., 2006 b. Moluscos exoticos no
Estado de Santa Catarina. Informativo SBMa, 37: 6-8.
Agudo-Padron A.I., 2006. Intermediate host mollusks
(Gastropoda: Pulmonata) of parasitic diseases in Santa
Catarina State, Southern Brazil, with inclusion of new
records to add to regional inventory. Ellipsaria, 8: 11-12.
Agudo-Padron A.I., 2007a. Moluscos e saude publica no
Estado de Santa Catarina. Informativo SBMa, 38: 4-6.
Agudo-Padron A.I., 2007b. Diagnostico sobre a potencial
ocorrencia do mexilhao-dourado asiatico, Limnoperna
fortunei (Dunker, 1857), no Estado de Santa Catarina,
Brasil. Informativo SBMa, 38: 4-5.

Agudo-Padron A.I., 2008a. Levantamento biogeografico de
moluscos no Estado de Santa Catarina, SC, regiao Sul do
Brasil, Vertente Atlantica do Cone Meridional da America
do Sul. Caminhos de Geografia, 9: 126-133. Available
online at: http://www.caminhosdegeografia.ig.ufu.br/
viewarticle.php?id=664&layout=abstract
Agudo-Padron A.I., 2008b. Vulnerabilidade da rede
hidrografica do Estado de Santa Catarina, Sc, ante o
avango invasor do mexilhao-dourado, Limnoperna
fortunei (Dunker, 1857). Revista Discente Expressdes
Geogi'aficas, 4: 75-103. Available online at: http://www.
geograficas.cfh.ufsc.br/arquivo/ed04/artigo04.pdf
Agudo-Padron A.I., 2008c. Occurrence of the invasive exotic
freshwater snail Melanoides tuberculatus (Muller, 1774) in
Santa Catarina State, Southern Brazil, and the potential
impl ications for the local public health. Ellipsaria, 10: 16-17.
Agudo-Padron A.I., 2008d. Ocorrencia confirmada da semi-
lesma exotica europeia Milax valentianus Ferussac, 1821
na regiao Sul do Brasil. Informativo SBMa, 39: 3.
Agudo-Padron A.I., 2009a. Recent terrestrial and freshwater
molluscs of Santa Catarina State, Sc, Southern Brazil
region: a comprehensive synthesis and check list.
VISAYA, April 20 2009: 1-12. Available online at:
http://www.conchology.be/?t=4 1

Agudo-Padron A.I., 2009b. Recent continental malacological
researches and inventory in the Southern Brazil and the
general “Atlantic Slope of the South Cone” region, South
America: a comparative relationship addenda. VISAYA,
April 20 2009: 1-4. Available online at: http://www
,conchology.be/?t=4 1

Agudo-Padron A.I., 2009c. Endangered continental mollusks
of Santa Catarina State, Southern Brazil: an overview.
Ellipsaria, 11: 7-8.

Agudo-Padron A.I., 2011a. Mollusc fauna of Santa Catarina
State, Central Southern Brazil: current state of knowledge.
Tentacle, 19: 22-24. Available online at: http://www.hawaii.
edu/cowielab/tentacle/Tentacle_ 1 9.pdf
Agudo-Padron A.I. , 2011b. The continental molluscs of Santa
Catarina State, Central Southern Brasil: need for more
population studies. Tentacle, 19: 24-26. Available online at:
http://www.hawaii.edu/cowielab/tentacle/Tentacle_ 1 9.pdf
Agudo-Padron A.I. & Bleicker M.S., 2009. Malacological
research in the Serra do Tabuleiro Ecological State Park,
Santa Catarina’s State, SC, Southern Brasil. Tentacle, 17:
9-12. Available online at: http://www.hawaii.edu/
cowielab/tentacle/tentacle_ 1 7.pdf
Agudo-Padron A.I. & Lenhard P., 2010. Introduced and
invasive mollusc in Brazil: brief overview. Tentacle, 18:
37-41. Available online at: http://www. hawaii.edu/
co wielab/tentacle/Tentacle_ 1 8 .pdf
IGNIS - Planejamento e In-formagao Ambiental. 2010. Lista
das Especies da fauna ameagadas de Extingao em Santa
Catarina. Itajai, SC: IGNIS. Available online at:
http://ignis.org.br/lista/

Lista de Especies da Flora e da Fauna Ameagadas no Estado
do Para - PA (2007). Species List of the Flora and Fauna
Threatened in the State of Para - PA, SEMA - Secretaria
de Estado de Meio Ambiente, Resolugao 054/2007,
24/10/2007, Belem/Para”

Lista Oficial das Especies da Flora e Fauna Ameagadas de
Extingao na Cidade do Rio de Janeiro, 1997. Rio de Janeiro
(Municipio). Decreto n.° 15.793, de 4 de junho de 1997.
Mansur M.C.D., 2008. Bivalves Sul- Americanos: uma
diversidade ameagada. Curitiba, Parana: XXVII Congresso
Brasileiro de Zoologia, Resumo de Palestra. Available
online at: http://www.cbz2008.com.br/ palestras/Maria%
20Cristina%20Mansur%20_%20malacologia.pdf
Mansur M.C.D., Heydrich I., Pereira D„ Richinitti L.M.Z.,
Tarasconi J.C. & RIOS E. de C., 2003. Moluscos. hr.
Fontana C.S., Bencke G.A. & Reis R.E., Livro vermelho
da fauna ameagada de extingao no Rio Grande do Sul.
Porto Alegre, RS: EDIPUCRS, pp. 49-71.

MMA - Ministerio do Meio Ambiente. 2004. Lista Nacional
das Especies de Invertebrados Aquaticos e Peixes
Ameagadas de Extingao. Instrugao Normativa No. 5 de 2 1
Maio 2004. Brasilia, DF: Diario Oficial da Uniao, Segao
1, No. 102, 28/05/2004, pp.136-138.

A. I. Agudo-Padron

Ministerio do Meio Ambiente, 2008. Livro Vermelho da Fauna
Brasileira Amcacada de Extingao, Vol. 1 . Biodiversidade
19, Ed.: A. Barbosa Monteiro Machado, G. Moreira
Drummond, A. Pereira Paglia; Brasilia, 510 pp.)

Moraes M.S., 2006. O manual dos moluscos do Brasil. Jomal
da USP, 22 7. Available online at: http://www.usp.br/
jomsp/arquivo/ 2006/jusp783/pag07.htm
Silva M.C.P. & Veitenheimer-Mendes I.L., 2004. Rcdescricao
de Potamolithus catharinae com base em topotipos

(Gastropoda, Hydrobiidae), rio Hercilio, Santa Catarina,
Brasil. Iheringia, Serie Zoologia, 94: 83-88. Available
online at: http://www.scielo.br/pdEisz/v94nl/20466.pdf
Simone L.R.L., 2002. Terminado o levantamento sobre a
biodiversidade de moluscos continentais do Brasil.
Informativo SBMa, 33: 6.

Simone L.R.L., 2006. Land and freshwater molluscs of Brazil.
Sao Paulo, FAPESP, 390 pp.

Biodiversity Journal, 2011, 2 (2): 67-72

Contribution to the Knowledge of longhorn beetles (Coleoptera,
Cerambycidae) from Kenya

Vladimir Sakalian 1 & Georgi Georgiev 2

1 Institute of Biodiversity and Ecosystem Research of Bulgarian Academy of Sciences 1 Tzar Osvoboditel Blvd., 1000, Sofia, Bulgaria; e-mail:
sakalian@online.bg. - 2 Forest Research Institute of Bulgarian Academy of Sciences 132 St. Kliment Ohridski Blvd., 1756 Sofia, Bulgaria; e-
mail: ggeorgiev_fri@mail.bg

ABSTRACT As a result of expeditions of the first author in Kenya during the period 2003-2006, 40 species and subspecies
of longhorn beetles were collected and later determined by Dr. Karl Adlbauer. The faunistic list reports on
recent nomenclature, localities of collection as well as geographical distribution of established taxa.

KEY WORDS Cerambycidae, longhorn beetles, Kenia.

Received 09.03.2011; accepted 20.04.2011; printed 30.06.2011

INTRODUCTION

The cerambycid fauna of Ethiopian zoogeo-
graphical region includes over 3,000 valid species,
but its actual number is undoubtedly greater due to
the insufficient knowledge about longhorn beetles
in the tropics and subtropics (Plavilstshikov,
1936). During the period 2003-2006, the first
author collected many different insect species in
Kenya. Among the other coleopterological
material, a total number of 40 longhorn beetles
were established. The main purpose of this note is
to announce the species collected and to give
some data about their distribution.

MATERIALS AND METHODS

The study was conducted in different regions
of Kenya during the period 2003-2006 (Figs. 1-
6). The longhorn beetles were collected by
traditional entomological methods:

• Hand collection of cerambycids on flowers
and food plants (Fig. 7);

• Collection of cerambycids on grass and
bushes by entomological bag;

• Shaking of tree branches and crowns and
collection of fallen insects;

• Collection of cerambycids in sticky traps;

• Attracting cerambycids to lamp light;

• Rearing of adults in laboratory conditions
from infested parts of food plants.

Collected cerambicids were identified by Dr.
Karl Adlbauer.

Studied material is deposited in the Institute
of Biodiversity and Ecosystem Research of
Bulgarian Academy of Sciences Scientific Found
(Sofia, Bulgaria). Single specimens are kept in
K. Adlbauer ’s collection.

RESULTS AND DISCUSSION

PRIONINAE

Macrotomini

Macrotoma palmata (Fabricius, 1792)

Kenya, Elementeita Lake (00°28 , 31 ,, S,
36°15’46 ,, E), 1820 m, 14/15.IV.2006, 10 exx.;
North-east Kenya, Lower Tana River, Gamba
Guest House, stickly traps, 20/23. IV.2006, 1 ex.

Distribution: From Marocco to Saudi Arabia
and RSA, Mauritius (Adlbauer et al., 2008).

Prionotoma jordani (Lameere, 1903)

Kenya, Bogoria Lake, 11.04.2004, 1 ex.
Distribution: From Senegal to Burundi and
Angola (Delahaye et al., 2006).

V. Sakalian & G. Georgiev

Fig. 5

Fig. 6

Figure 1. Kenia, Arabuko-Sokoke forest (photo Eduard Jendek).

Figure 2. Kenia, Elementeita lake (photo Eduard Jendek).

Figure 3. Kenia, dead trunk of Acacia sp. near Elementeita lake - habitat of Macrotoma palmata (photo Eduard Jendek).
Figure 4. Kenia, Taita hills forest (photo Eduard Jendek).

Figure 5. Tana river (photo Gianfranco Curletti).

Figure 6. Kenia, Acacia lahai forest in Ngong hills - favorite place for many coleopteran species (photo Eduard Jendek).

Fig. 1

Fig. 3

Contribution to the Knowledge of Longhorn Beetles (Coleoptera, Cerambycidcie) from Kenya

CERAMBYCINAE

Xystrocerini

Xystrocera dispar Fahraeus,1872

Kenya, Nyanza District, Ruma National Park,
1050 m, 04.VII.2003, 1 ex.; Kenya, Lower Tana
River, Gamba, 25/27.X.2005, 3 exx.

Distribution: Tschad, Sudan, Saudi Arabia,
Namibia and RSA (Adlbauer et al., 2008).

Cerambycini

Neoplocaederus spinicornis (Fabricius, 1781)

Kenya, Lower Tana River, Gamba Guest
House, stickly traps, 20/23. IV.2006, 2 exx.

Distribution: Mauretania, Zimbabwe (Adlbauer
et al., 2008).

Figure 7. Oligosmerus sp. (photo Eduard Jendek).

Molorchini

Merionoeda africana Distant, 1899

NE Kenya, Arabuko - Sokoke Forest,
24/25. IV.2006, 1 ex.

Distribution: Congo-Kinshasa, Kenya, RSA
(Adlbauer, 1995).

Callichromatini

Litopus geniculatus Harold, 1880

Kenya, Road Nairobi-Namanga, Nikobe,
1500 m, 04.XII.2003, 1 ex.

Distribution: Ethiopia, Tanzania (Adlbauer et
al., 2008).

Litopus kenyensis Adlbauer, 2002

Kenya, Malindi, Kipepeo farm, (03°13’S,
40°06’E), 30 m, 24/25.VI.2006, 2 exx. (+ 1 ex. in
K. Adlbauer’s collection) (Adlbauer, 2002).
Distribution: Kenya.

Paracolobizus bicolor (Schmidt, 1922)

Kenya, Malindi, Kipepeo farm, (03°13’S,
40°06’E), 30 m, 24/25. VI.2006, 2 exx.

Distribution: Kenya, Tanzania (Juhel, 2010).

Cloniophorus nyassae (Bates, 1878)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,
1 ex.

Distribution: Kenya, Malawi (Schmidt, 1922).

Closteromerus claviger laevipes Fairmaire, 1887
Kenya, Nairobi, 20.IV.2004, 6 exx.; Kenya,
Ngong Hills Kiserian Distr. (01°26’56”S,
36°38’19”E), 1940 m, 17.IV.2006, 6 exx.

Distribution: Cameron, Eritrea, Somalia,
Tanzania (Adlbauer et al., 2008).

Rhopalomeces fulgurans Schmidt, 1922

Kenya, Nyanza Province, Mbita, (0°24’S,
34°12’E), 1050 m, 18.V.2003, 1 ex.; Kenya, Rifl
Valley, Province N Kiserian, 1700 m, 10.VI.2003,
3 exx.; Kenya, Nairobi, 25.XI-20.XII.2003, 2
exx.; Kenya, Nairobi, 20.IV.2004, 3 exx.; Kenya,
Narolc, 1750 m, 12.V.2004, 1 ex.; Kenya, Nairobi,
10.V.2004, 1 ex.; Central Kenya, Elementeita
Lake 1700 m, 12.V.2005, 1 ex.; Kenya, Ngong
Hills, Kiserian Distr. (01°26’56”S, 36°38 , 19”E),
1940 m, 17.IV.2006, 11 exx.

Distribution: Tanzania (Schmidt, 1922).

Rhopalomeces gracilis (Fahraeus, 1872)

NE Kenya, Arabuko - Sokoke Forest,
24/25. IV.2006, 1 ex.; Kenya, Malindi, Kipepeo farm
(03°13’S, 40°06’E), 30 m, 24/25 .VI.2006, 3 exx.

Distribution: Congo-Kinshasa, RSA (Adlbauer,
1995).

Promeces longipes (Olivier, 1795)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,
1 ex.

Distribution: Mocambique, RSA (Adlbauer,

2001 ).

V. Sakalian & G. Georgiev

Promeces suturalis (Harold, 1878)

Kenya, Gamba Distr., 14.0IV.2006, 1 ex.;
Kenya, Elementeita Lake (00 o 28’31”S,
36°15 , 46”E), 1820 m, 14/15.IV.2006, 1 ex.
Distribution: Kenya, Tanzania (Schmidt, 1922).

Hypargyra albilateris ssp. typ. (Harold, 1880)

Kenya, Rifl Valley, Province N Kiserian,
1700 m, 10.VI.2003, 2 exx.; Kenya, Nairobi,
20.IV.2004, 1 ex.; Kenya, Ngong Hills, Kiserian
Distr. (01 o 26’56”S, 36 0 38’19”E), 1940 m,
17.IV.2006, 4 exx.; NE Kenya, Malindi, Kipepeo
Farm, 24.IV.2006, 1 ex.

Distribution: Ethiopia, Kenya, Tanzania
(Juhel & Bentanachs, 2009).

Clytini

Calanthemis subcruciatus (White, 1855)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,
3 exx.; NE Kenya, Arabuko - Sokoke Forest,
24/25. IV.2006, 1 ex.

Distribution: Somalia, RSA (Adlbauer, 1995).

LAMIINAE

Phantasini

Phantasis avernica Thomson, 1865

Kenya, Elementeita Lake (00°28’31”S,
36°15’46 ,, E), 1820 m, 14/1 5. IV.2006, 1 ex.

Distribution: Sudan, RSA (Sudre & Teocchi,

2000).

Lamiini

Monochamus spectabilis (Perroud, 1855)

NE Kenya, Malindi, Kipepeo Farm, 24.IV.2006,
1 ex.

Distribution: Ethiopia, Congo-Brazzaville,
RSA, Madagascar, Comores (Adlbauer et al.,
2008).

Morimopsini

Monoxenus infraflavescens Breuning, 1949

Kenya, Ngangao Forest, (03°2r59”S,
38°20’26”E), 1850 m, 4.XI.2005, 1 ex.
Distribution: Kenya (Breuning, 1950).

Mesosini

Coptops aedificator (Fabricius, 1792)

Kenya, Lower Tana River, Sailoni,
25.X.2005, 1 ex.

Distribution: Africa (including Seychelles,
Comores, Madagascar), Saudi Arabia, SE-Asia,
Hawaii (Adlbauer et ah, 2008).

Tragocephalini

Spilotragus guttatus (Jordan, 1903)

Kenya, Road Nairobi-Namanga, Nikobe,
1500 m, 04. XII. 2003, 1 ex.; Central Kenya, Road
Kiserian to Oltepesi, 1770 m, 05.V.2005, 1 ex.
Distribution: Kenya (Breuning, 1934).

Pseudochariesthes nigroguttata (Aurivillius, 1908)

Central Kenya, Road Kiserian to Oltepesi,
1770 m, 05.V.2005, 1 ex.

Distribution: Kenya, Tanzania (Breuning, 1934).

Prosopocerini

Prosopocera peeli (Gahan, 1910)

Central Kenya, Elementeita Lake 1700 m,
12.V.2005, 1 ex.

Distribution: Ethiopia, Somalia, Kenya,
Tanzania (Adlbauer et ah, 2008).

Ceroplesini, Subtribus Crossotina

Frea marmorata Gerstaecker, 1871

NE Kenya, Arabuko - Sokoke Forest, ex.
Albicia sp., 24/25. IV.2006, 1 ex.

Distribution: Kenya, Zimbabwe (Breuning, 1942).

Frea aedificatoria Hintz, 1910 =Frea sublineata
Breuning, 1956

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,
3 exx.

Distribution: Kenya, RSA (Breuning, 1942).

Crossotus plumicornis Serville, 1835

Kenya, Nyanza District, Ruma National Park,
1050 m, 04.VII.2003, 1 ex.; Kenya, Lower Tana
River, ex. Acacia sp., 25.X.2005, 1 ex.

Distribution: Mauritania, RSA (Sudre et ah,
2007).

Contribution to the Knowledge of Longhorn Beetles (Coleoptera, Cerambycidcie) from Kenya

Crossotus barbatus Gerstaecker, 1871

Kenya, Road Nairobi-Namanga, Nikobe,
1500 m, 04.XII.2003, 1 ex.

Distribution: Sudan, Somalia, Kenya, ?Malawi
(Sudre et al., 2007).

Ceroplesini, Subtribus Ceroplesina

Ceroplesis revoili pauli Fairmaire, 1884

South Kenya, Jipe Lake Forest, ex. Acacia
sp., 1 ex.

Distribution: Somalia, Kenya, Tanzania
(Breuning, 1937).

Ceroplesis bicincta (Fabricius,1798) (Fig. 8)

Kenya, Ngong Hills, Kiserian Distr.
(01°26’56”S, 36°38’19”E), 1940 m, 17.IV.2006,

1 ex.

Distribution: Congo-Kinshasa, RSA (Adlbauer,

2001).

Ceroplesis strandi Breuning, 1935

Western Kenya, Narok, 1750 m, 12.V.2004, 1
ex.; Western Kenya, Narok, 1716 m, 18.V.2005,

2 exx. (+ 1 ex. in K. Adlbauer’s collection).

Distribution: Zambia, Kenya (Breuning, 1937).

Apomecynini

Enaretta caudata (Fahraeus, 1872)

Central Kenya, Bogoria Lake, 900 m,
31.XI.2005, 1 ex.

Distribution: Uganda, RSA (Adlbauer, 2001).

Eunidiini

Eunidia brunneopunctata strigatoides Breuning, 1939

Kenya, Road Nairobi-Namanga, Nikobe,
1500 m, 04.XII.2003, 1 ex.; Kenya, Lower Tana
River, Sailoni Forest (02°09’18”S, 40 o lL04”E),
22/23. IV.2006, 1 ex.; Kenya, Road Voi to Taveta,
Border of Tsavo West N. P. (03°30’10”S,
38°16’25”E), 28/30. IV.2006, 1 ex.

Distribution: Senegal, Ethiopia, RSA
(Adlbauer et al., 2008).

Figure 8. Ceroplesis bicincta on Acacia sp. (photo Eduard Jendek)

Pteropliini

Pterolophia variolosa Kolbe, 1894

NE Kenya, Arabuko-Sokoke Forest,
24/25. IV.2006, 1 ex.

Distribution: Kenya, Tanzania (Breuning,
1961a).

Saperdini

Glenea apicalis westermanni (Thomson, 1860)

Kenya, Gilgil Distr., 14. IV.2006, 1 ex.
Distribution: Togo, RSA (Adlbauer, 2001).

Glenea arida Thomson, 1865

NE Kenya, Arabuko-Sokoke Forest,

24/25. IV.2006, 1 ex.

Distribution: Kenya, RSA (Breuning, 1958).

Phytoecia (Plepisanis) neavei Aurivillius, 1914

Kenya, Narok, 1750 m, 12.V.2004, 1 ex.
Distribution: Kongo-Kinshasa, Uganda,
Malawi (Breuning, 1951).

Phytoecia (Plepisanis) suturevittata Breuning, 1951

NE Kenya, Arabuko-Sokoke Forest,
24/2 5. IV. 2 006, 2 exx. (+ 1 ex. in K. Adlbauer’s
collection).

Distribution: Kenya (Breuning, 1951).

Phytoecia (Psendoplepisanis) somereni Breuning, 1951

Kenya, Narok, 1750 m, 12.V.2004, 1 ex.
Distribution: Kenya (Breuning, 1951).

V. Sakalian & G. Georgiev

Oberea pagana Harold, 1880

Central Kenya, Road Kiserian to Oltepesi,
1750-1770 m, 05.V.2005, 1 ex.

Distribution: Ethiopia, Kenya (Adlbauer et
al., 2008).

Oberea cingulata Aurivillius, 1914

Kenya, Ngong Hills, Kiserian Distr., (01°26’56”S,
36°38’19”E), 1940 m, 17.IV.2006, 1 ex.

Distribution: Lake Victoria, Kenya, Tanzania
(Breuning, 1961b).

CONCLUSIONS

Four species found in this study are known
with limited distribution only in Kenya -
Monoxenus infraflvescens, Spilotragus guttatus,
Phytoecia suturevittata and P. somereni - which
make them potential endemics for this country.
Other five cerambycids appear to be most
probably new for Kenya: Prionotoma jordani,
Rhopalomeces fulgurans , Rhopalomeces
gracilis , Promeces longipes and Ceroplesis
bicincta. It could be noted that new records
enlarge our knowledge on these species
distribution and increase species diversity of
Kenyan fauna. As a main conclusion we have to
underline that the Kenyan longhorn beetles fauna
is partially and incompletely studied that is why
any new contribution is very important to enrich
our learning of this fauna.

ACKNOWLEDGEMENTS

We are very grateful to Dr. Karl Adlbauer
(Graz, Austria) for determination and comments
on the collected species.

REFERENCES

Adlbauer K., 1995. Bockkafer aus Zimbabwe und
Transvaal, Teil II. Cerambycinae (Coleoptera,
Cerambycidae). Lambillionea, 95: 477-496.

Adlbauer K., 2001. Katalog und Fotoatlas der Bockkafer
Namibias (Cerambycidae). Taita Publishers, Hradec
Kralove, 80 pp.

Adlbauer K., 2002. Neue Cerambyciden aus Afrika sowie
neue Synonymien (Coleoptera, Cerambycidae). Les
Cahiers Magellanes, 13: 1-10.

Adlbauer K., Ayalew A., Beck R. & Drumont A., 2008.
Cerambyciden aus Athiopien (Coleoptera,
Cerambycidae). Linzer biologische Beitrage, 40: 1153-
1191.

Breuning S., 1934-1935. Etudes sur les Lamiaires (Coleop.
Cerambycidae). Premiere Tribu: Tragocephalini
Thomson. Novitates Entomologicae, Suppl. 2-3: 7-98.
Breuning S., 1937. Quadrieme Tribu: Ceroplesini Thomson.

Novitates Entomologicae, Suppl. 3: 231-270.

Breuning S., 1942. Dixieme tribu: Crossotini Thoms.

Novitates Entomologicae, Supp. 3, Fasc. 73-84: 8-101.
Breuning S., 1950. Revision des “Morimopsini”.

Longicornia, 1: 161-262.

Breuning S., 1951. Revision du genre Phytoecia (Col.
Cerambycidae). Entomologische Arbeiten aus dem
Museum Frey, 2: 1-103 and 353-460.

Breuning S., 1958. Revision der Gattung Glenea Newm.
(Col. Ceramb.) (3. Fortsetzung und SchluB).
Entomlogische Arbeiten des Museums Frey, 9: 804-907.
Breuning S., 1961a. Revision des Pteropliini de l’Afrique
noire (Troisieme partie). Bulletin de FI.F.A.N., 23, ser.
A: 1054-1097.

Breuning S., 1961b. Revision systematique des especes du
genre Oberea Mulsant du globe (Coleoptera
Cerambycidae) (2 me partie). Frustula Entomologica, 4:
61-140.

Delahaye N., Drumont A. & Sudre J., 2006. Catalogue des
Prioninae du Gabon (Coleoptera, Cerambycidae).
Lambillionea, 106, supp.: 1-32.

Juhel P., 2010. Troisieme contribution a l’etude des
Callichromatini africains: a propos du genre Colobizus
Schmidt, 1922 (Coleoptera, Cerambycidae, Cerambycinae).
Les Cahiers Magellanes, NS, 2: 31-38.

Juhel P. & Bentanachs J., 2009. Revision du genre
Helymaeus Thomson, 1864 et les genres voisins
(Coleoptera, Cerambycidae, Cerambycinae). Magellanes,
Collection systematique, 22: 1-81.

Plavilstshikov N., 1936. Faune de l’URSS. Insectes
Coleopteres. 21. Cerambycydae (P. 1), Moscou-
Leningrad, Edition de l’Academie des Sciences de F
URSS. 612 pp.

Schmidt M., 1922. Die afrilcanischen Callichrominen (Col.

Ceramb.). Archiv far Naturgeschichte, 6: 61-232.

Sudre J. & Teocchi P., 2000. Revision de la tribu des
Phantasini (Col. Cerambycidae, Lamiinae). Magellanes,
Collection systematique, 4: 1-81.

Sudre J., Teocchi P., Sama G. & Rousset F., 2007. Les
genres Crossotus , Biobessoides et Epidicho states
(Coleoptera, Cerambycidae, Lamiinae, Crossotini).
Magellanes, Collection systematique, 15: 1-78.

Biodiversity Journal, 2011, 2 (2): 73-84

Genetic diversity analysis of the durum wheat Graziella Ra,
Triticum turgidum L. subsp. durum (Desf.) Husn. (Poales, Poaceae)

M. Stella Colomba & Armando Gregorini 1

1 Dipartimento di Scienze della Terra, della Vita e dell’ Ambiente (DiSTeVA), Universita di Urbino “Carlo Bo”, Via Maggetti 22, 61029 Urbino
(PU), Italy ^Corresponding author, email: mariastella.colomba@uniurb.it

ABSTRACT For the first time, the durum wheat Graziella Ra was compared to four Italian durum wheat varieties (Cappelli,
Grazia, Flaminio and Svevo) and to Kamut in order to preliminary characterize its genome and to investigate
genetic diversity among and within the accessions by Amplified Fragment Length Polymorphisms (AFLPs),
Simple Sequence Repeats (SSRs) and a-gliadin gene sequence analysis. The main aim of the study was an
attempt to determine the relationship between the historic accession Graziella Ra and Kamut which is
considered an ancient relative of the durum subspecies. In addition, nutritional factors of Graziella Ra were
reported. Obtained results showed that (i) both AFLP and SSR molecular markers detected highly congruent
patterns of genetic diversity among the accessions showing nearly similar efficiency; (ii) for AFLPs,
percentage of polymorphic loci within accession ranged from 6.57% to 19.71% (mean 12.77%) and, for SSRs,
from 0% to 57.14% (mean 28.57%); (iii) principal component analysis (PC A) of genetic distance among
accessions showed the first two axes accounting for 58.03% (for AFLPs) and 61.60% (for SSRs) of the total
variability; (iv) for AFLPs, molecular variance was partitioned into 80% (variance among accessions) and 20%
(within accession) and, for SSRs, into 73% (variance among accessions) and 27% (within accession); (v)
cluster analysis of AFLP and SSR datasets displayed Graziella Ra and Kamut into the same cluster; and (vi)
molecular comparison of a-gliadin gene sequences showed Graziella Ra and Kamut in separate clusters. All
these findings indicate that Graziella Ra, although being very similar to Kamut, at least in the little part of the
genome herein investigated by molecular markers, may be considered a distinct accession showing appreciable
levels of genetic diversity and medium-high nutritional qualities.

KEY WORDS AFLP, a-gliadin gene, durum wheat; genetic diversity analysis, nutritional qualities, SSR; Triticum.

Received 12.04.2011; accepted 20.05.2011; printed 30.06.2011

INTRODUCTION

Durum wheat ( Triticum turgidum L. subsp.
durum) is the only tetraploid (AABB, 2n=4x=28)
species of wheat of commercial importance that
is widely cultivated today. It originated
thousands of years ago from a hybridization
(pollen exchange) of the wild diploid T.
monococcum L. (A genome) and the donor of the
B genome which, according to morphological,
geographical and cytological evidence, has
recently been recognized as T. speltoides
(Tausch) Gren. or a closely related species (von
Buren, 2001). In the last decades, a huge number
of durum wheat cultivars have been obtained by

artificial selection, generally based on high yield,
disease resistance and technological qualities
(e.g. bread- or pasta-making qualities) with little
emphasis on taste or dietary components. On the
other hand, at the same time, traditional local
varieties have been considerably reduced as a
result of the diffusion of new varieties of wheat.
To preserve genetic variability and reduce
genetic erosion it is extremely important
developing and maintaining local collections,
including old cultivars and landraces, which - at
least in some cases - may be employed for niche
cereal-based typical products. This was the case
of Graziella Ra, an ancient accession (not a
cultivar) of durum wheat which, thanks to its

M. Stella Colomba & Armando Gregorini

good taste and fine pasta-making qualities,
recently appeared on the market as Graziella
Ra®, an Italian trademark used in marketing
products made with the homonymous grain.
Currently, it is organically grown in Marches
(central Italy) by Alee Nero Cooperative
(Urbino, PU) mainly with the aims to contribute
to the preservation of local biodiversity and
increase the interest for ancient crops which are
at the basis of the Mediterranean diet.

This study was designed with the intent of
providing a preliminary characterization of
Graziella Ra genome, analysed for the first time.
To this aim, other five accessions chosen as
representatives of modern (Grazia, Flaminio,
Svevo), traditional (Cappelli) and ancient
(Graziella Ra, Kamut) wheats were selected to
obtain a small set of three modem and three older
durum accessions. Comparative analysis was
carried out by AFLPs (Amplified Fragment
Length Polymorphisms), microsatellites (SSRs,
Simple Sequence Repeats) and the a-gliadin
gene sequence to evaluate genetic diversity
within and among wheats under study.

MATERIALS AND METHODS
Accessions

Figure 1. Spike morphology of Graziella Ra (la) and Kamut (lb)
durum wheats.

lax with long narrow white glumes. The spikelet
lemmas have long and strong, more or less
deciduous, white or black awns (Fig. lb). The
grains are very large - up to twice the size of
bread wheat kernels - narrow, vitreous, and flinty
with a characteristic hump. The correct
subspecies is still in dispute; in fact, according to
Stallknecht et al. (1996), Kamut has been
classified, from time to time, as T. turgidum
polonicum , T. turgidum turanicum or T. turgidum
durum. Although its taxonomy is contentious, it is
considered an ancient relative of durum subspecies.
All wheats were provided by Alee Nero
Cooperative, with the exception of Kamut, kindly
supplied by Molini del Conero (Osimo, AN, Italy).

Graziella Ra (Fig. la) is a type of durum
wheat characterized by low yield (15-20 quintals
per hectare), medium-long cycle, tall size (about
120 cm) and a phenotype very similar to Kamut’ s
(see below) with large ears and long aristas. It
was brought to Italy at the end of ‘70s (see
http://www.alcenerocooperativa.it/pagina.asp7pa
g=443), forgotten for a long time and
rediscovered a few years ago due to its fine pasta-
making qualities. Cappelli is an Italian traditional
strain of durum wheat which deserves a
privileged place among the varieties of old
established durum wheat for being the very first
selected variety. Svevo, Grazia and Flaminio are
modern cultivars, with a great commercial
importance, employed for pasta or bread-making.
Kamut is a registered trademark of Kamut
International, Ltd., used in marketing products
made with the variety QK-77. It is characterized
by erect young shoots with very narrow
pubescent leaves, the plants tiller very little and
the straw thin. The spikes are narrow, lax or very

DNA extraction

Several seeds of each line were germinated in
the dark for two days. The seedlings were grown
in daylight for seven days. Leaf tissues -
sampled at the four-leaf stage from twenty
different plants per accession - were immediately
frozen in liquid nitrogen and ground in a mortar
with a pestle. Thirty mg of powder were used for
DNA extraction following the cetyltrimethylam-
monium bromide (CTAB) protocol (Doyle &
Doyle, 1990) with slight modifications. DNA
quality was tested by a 0.8% agarose gel
electrophoresis.

AFLP

AFLP genotyping was performed at Keygene
NV (Wageningen, The Nertherlands) using their
standard in-house developed protocols (Vos et
al., 1995). Briefly, DNA extracted from four
different plants for each parental line (for a total

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 75

of twenty-four samples) was fingerprinted using
ten AFLP primers, five Pstl (indicated as P35,
P36, P39, P41, P42) and five Taql (T40, T41,
T42, T44, T46) (Table 1) arranged in eight
primer combinations (P35/T44; P35/T46;

P36/T46; P39/T41; P39/T42; P41/T40; P41/T41
and P42/T41) (Table 2).

Micro satellite gen oty ping

Twelve different plants per accession
(seventy-two individuals) were employed. Nine
Simple Sequence Repeat (SSR) markers were
selected from several ones tested on the grounds
of their Tm, length and degree of polymorphism.
Primers are listed in Table 3 . A tailed PCR primer
was used for SSR analysis by adding a 19-base
Ml 3 oligo sequence (Ml 3 tail) to the 5' end of
each forward SSR primer. Thus, each SSR
reaction used three primers: two unlabelled SSR
primers one of which having an attached M13
sequence tail (5’-CACGACGTTGTAAAACG
AC-3’), and one universal FAM-labelled Ml 3
primer with the same sequence as the Ml 3 tail
(Schuelke, 2000; Boutin- Ganache et al., 2001;
Fukatsu et al., 2005). PCR reactions were carried
out in 10 pi of a solution containing 10 ng
genomic DNA, lx Mg-free PCR buffer solution,
0.25 mM dNTPs, 1 .5 mM MgCl 2 , 50 nM forward
primer, 5.0 nM reverse primer, 500 nM Ml 3-
labelled primer, 0.5 U AmpliTaq Gold DNA
polymerase (Applied Biosystems) and nuclease-
free water. Amplification was performed as
follows: 5 min at 95 °C; 20 sec at 94 °C, 30 sec
at 55 °C, 30 sec at 72 °C (42 cycles); and a final
extension stage of 5 min at 72 °C. PCR products
were separated with an ABI 3730 DNA
sequencer (Applied Biosystems) and the
fragments were sized by means of a ladder
labelled with a fluorochrome VIZ (LIZ500,
Applied Biosystems). Data were analysed with
GeneMapper 3.0 (Applied Biosystems).

A-gliadin gene Amplification, Cloning, Sequencing
and Analysis

DNA from two plants per accession (total of
twelve samples, different from samples
employed for molecular markers) was used for
PCR amplifications of the a-gliadin gene. Both
forward (5 ’-ATGAAGACCTTTCTCATCC-3 ’)

and reverse (5 ’-YYAGTTRGTACCGAAGATG
CC-3’) primers were designed on the conserved
5’ and 3’ ends of the coding region of the a-
gliadin gene sequences downloaded from the
GenBank database (ID: DQ296195, DQ296196
and AJ870965). PCR amplifications were carried
out - using a high fidelity Pfu DNA Polymerase
(Promega) - as follows: 95 °C for 2 min; 95 °C
for 1 min, 60 °C for 30 sec, 72 °C for 2 min (30
cycles); 72 °C for 5 min. Reaction products were
visualized by electrophoresis on a 1.2% agarose
gel containing TBE IX buffer and ethidium
bromide (0.5 pg/ml). An aliquot (1 pi) of the
PCR product was inserted into a pCR 4-TOPO
vector by the TA-cloning system and
transformation was performed on E. coli TOP 10
cells following the manufacturer’s instructions
(Invitrogen). Selected transformants were
analysed for presence of the insert by PCR,
grown in LB medium overnight and purified by
the Wizard Plus SV minipreps kit (Promega).
Finally, sequencing of plasmid inserts was done
by using automated DNA sequencers at Eurofms
MWG Operon. Sequences were visualized with
BioEdit Sequence Alignment Editor 7 (Hall,
1999), aligned with the ClustalW option included
in this software and double checked by eye.
Standard measures of nucleotide polymorphism
[mean pairwise differences (k), nucleotide
diversity (n = Pi and 7i JC = Pi corrected according
to Jukes and Cantor) and nucleotide divergence
(D xy ) between accessions] using the full set of all
sequences were computed by DNAsp 5 (Librado
& Rozas, 2009).

Statistical analysis

For AFLP and SSR datasets, analyses were
performed within GenAlEx 6.4 (Peakall &
Smouse, 2006), a user-friendly package with an
intuitive and consistent interface that allows to
analyse a wide range of population genetic data,
including both dominant (AFLP) and
codominant (SSR) datasets, within MS Excel.
For each accession, allele number (Na),
heterozygosity (He), number and frequency of
genotypes and percentages of polymorphic loci
were obtained by the software. Polymorphism
information content (PIC) of each SSR was
computed according to Botstein et al. (1980).
Nei’s unbiased genetic distance (Nei, 1978) was

M. Stella Colomba & Armando Gregorini

Primer name

sequence

P35

5 ’-GACTGCGTACATGCAG ACA-3 ’

P36

5 ’-GACTGCGTACATGCAG ACC-3’

P39

5’ -GACTGCGTACATGCAG AGA-3 ’

P41

5’ -GACTGCGTACATGCAG AGG-3’

P42

5 ’-GACTGCGTACATGCAG AGT-3’

T40

5’-GATGAGTCCTGACCGA AGC-3’

T41

5 ’-GATGAGTCCTGACCGA AGG-3’

T42

5’-GATGAGTCCTGACCGA AGT-3’

T44

5 ’-GATGAGTCCTGACCGA ATC-3’

T46

5-GATGAGTCCTGACCGA ATT-3’

Table 1.

P.st] (P) and Taql (T) primers employed for AFLP analysis

Primer combinations

No. of polymorphic bands

Mean diversity index (He)

Marker index*

P35/T44

0.082

1.56

P35/T46

0.018

0.20

P36/T46

0.087

1.39

P39/T41

0.044

1.01

P39/T42

0.003

0.04

P41/T40

0.010

0.17

P41/T41

0.029

0.38

P42/T41

0.032

0.80

*MI = (no. of polymorphic loci/PC) x (mean diversity index/PC); for details, see Powell et al. (1996).

Table 2. Polymorphism features of the eight AFLP primer combinations (PCs) used to estimate genetic
similarities among wheat accessions under study.

SSR

Primer sequence

Bare 174

For 5’ - TGGCATTTTTCTAGCACCAATACAT

Rev 5’ - GCGAACTGGACCAGCCTTCTATCTGTTC

DuPw2 1 7

For 5’ -CGAATTACACTTCCTTCTTCCG

Rev 5’ -CGAGCGTGTCTAACAAGTGC

Xgwm750

For 5’ - CTTGCACAGAGACGATGCAT

Rev 5 ’-TGAGTCAGTCTCACAACCGG

Xgwml045

For 5’ - ATCACAAGGAGTTTATCGCT

Rev 5’- GTCAATGGACCATGGGATTC

Xgwml038

For 5’ - GTGCTCCATGGCGTCTG

Rev 5’ - AGTCCAGCAAACATTCTCCA

Xgwml26

For 5’ - CACACGCTCCACCATGAC

Rev 5’ - GTTGAGTTGATGCGGGAGG

Xgwml027

For 5’ - CAGTTCTCCCGGCATGTATT

Rev 5’ - TTCACATTGTCGCGTTGAAT

Table 3. List of primers used for SSR analysis

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 77

calculated in the TFPGA program (Miller, 1997).
For both AFLPs and SSRs, phenetic diagrams
were constructed on corresponding pairwise
genetic distance matrices by the Unweighted
Pair-Group Method using Arithmetic averages
(UPGMA) (Sneath & Sokal, 1973) with the
UPGMA tree searching algorithm of the
software. A thousand replicate distance matrices
were bootstrapped to evaluate the robustness of
the trees. For both datasets, analysis of molecular
variance (AMOVA) was carried out to examine
total genetic variation among and within
accessions; in addition, Principal Component
Analysis (PC A) was performed in order to more
effectively view the patterns of genetic distance.
A Mantel test was used to detect the possible
correlation between AFLP and SSR accession
matrices. Statistical significance was determined
by random permutations, with the number of
permutations set to 9,999.

Phylogenetic analysis

Phylogenetic analyses were conducted in
MEGA 5 (Tamura et al., 2011) and BEAST 1.4.8
(Drummond & Rambaut, 2007) by Maximum
Likelihood (ML) and Bayesian Inference (BI).
For maximum likelihood analyses, the most
appropriate model of DNA substitution resulted
HKY (Hasegawa Kishino Yano). Bayesian
analysis was conducted by BEAST where the
topology and divergence times can be estimated
simultaneously from the data and therefore a
starting tree topology is not required, making it
particularly appropriate for groups with
uncertain phylogenies. BEAST input files were
generated with BEAUTi (v 1.4.8) using the a-
gliadin gene dataset (nexus format) and a HKY
substitution model. For partition into codon
positions, the SRD06 model (Shapiro et ah,
2006) was selected; this model links 1st and 2nd
codon positions but allows the 3rd positions to
have a different relative rate of substitution,
transition-transversion ratio and gamma
distributed rate heterogeneity and has been found
to provide a better fit for protein-coding
nucleotide data. BEAST was run for 1,000,000
generations with samples taken every 100
generations. Five independent Markov Chain
Monte Carlo (MCMC) runs were conducted and
the log and tree files were combined using

LogCombiner (v 1.4.8). The results were
examined by Tracer (v 1.5) to confirm stationary
distribution and adequate effective sample sizes
(i.e. ESS>200) for all parameters, indicating that
the sampled generations were uncorrelated and
the posterior distribution of the parameter was
long and accurate. TreeAnnotator (v 1.4.8) was
then used to summarize a best supported tree and
annotate the tree with posterior probabilities of
the nodes under investigation. FigTree (v 1.3.1)
was used to display the 95% confidence
intervals. BEAST, BEAUTi, LogCombiner,
Tracer, TreeAnnotator and FigTree were
downloaded from http://beast.bio.edu.ac.uk.

Support for the internodes was assessed by
bootstrap percentages (100 replicates for ML),
whereas for Bayesian inference tree, the
Bayesian posterior probability was computed. A-
gliadin gene sequences from Triticum aestivum
L. (GenBank ID: DQ 1663 77) and T. dicoccoides
Korn. (GenBank ID: DQ 1403 52) were employed
as outgroups.

Nutritional quality

Graziella Ra was investigated by Eurofins
Biolab srl (an Italian company specialized in
assays and controls, and in biological,
microbiological and chemical determinations)
using their standard in-house developed
protocols; each analysis was made in triplicates.
For Kamut, we report nutritional values available
at http://www.kamut.com.

RESULTS AND DISCUSSION
Molecular marker variation

A total of twenty-four individuals were
investigated using eight AFLP primer
combinations. One sample (from Svevo) didn’t
generate reliable fingerprintings and was
excluded from the analysis which, therefore,
resulted in twenty-three individuals showing a
total of 137 markers. For each AFLP primer
combination, number of polymorphic bands,
mean heterozygosity and marker index are
reported in Table 2. The presence/absence of
each fragment was encoded as a 1/0 score,
generating a binary data matrix. Within each
accession, mean heterozygosity ± standard error

M. Stella Colomba & Armando Gregorini

SSR

Chromosome

Allele 1

Allele 2

Allele 3

Allele 4

Allele 5

Allele 6

PIC

Mean He

MI*

Xgwml26

203

206

212

214

0.60

0.111

0.44

Barcl74

200

201

216

0.45

0.030

0.09

Xgwml045

192

198

202

0.61

0.058

0.17

Xgwml038

235

241

242

252

254

274

0.35

0.072

0.43

Xgwm750

230

234

236

249

0.68

0.102

0.41

Xgwml027

125

129

138

0.67

0.074

0.22

DuPw2 1 7

232

241

242

0.30

0.025

0.07

MI = (no. of polymorphic bands/SSR) x (mean diversity index/SSR); for details see Powell et al. (1996).

Table 4. List of all the alleles revealed by the microsatellites in the six accessions. Chromosome mapping, PIC, Polymorphism Information
Content; He, heterozygosity (also called diversity index); MI, Marker index are reported. Please note that alleles are expressed in nucleotide
length (bp = base pairs).

and percentage of polymorphism resulted
specifically: 0.024±0.008, 6,57% (Svevo);
0.081±0.014, 22.63% (Flaminio); 0.027±0.008,
8.03% (Kamut); 0.051±0.012, 11.68% (Graziella
Ra); 0.034±0.010, 8.03% (Cappelli); and
0.083±0.015, 19.71% (Grazia). Percentage of
polymorphism was, on average, 12.77%.

SSR data were classified according to a
qualitative scale, with scores ranging from 1 to 5,
describing the complexity of the amplification
profile for each primer (Stephenson et al., 1998).
Out of nine markers considered, seven [Bare 174,
Xgwm750, Xgwml038, Xgwml26 and
Xgwml027 (score 1, 2); Xgwml045 and
DuPw217 (score 3)] were included in the
analysis; whereas two (Xgwmll36 and
Xgwml009) failed to give rise to any
amplification products. SSRs revealed a total of
26 alleles in the six accessions. The number of
alleles per locus varied among these markers,
ranging from three (DuPw217, Bare 174,
Xgwml027, Xgwml045) to six (Xgwml038)
with an average of 3.7. As a measure of the
informativeness of microsatellites, the average
PIC (Polymorphism Information Content) value
was 0.53, ranging from 0.30 (DuPw217) to 0.68
(Xgwm750). For each marker, number of alleles,
PIC value, mean heterozygosity and marker index
(MI), a universal metric to represent the amount
of information obtained per experiment, are
reported in Table 4. As shown, marker index
values are not very high but, on the other hand,
considering that a PIC value >0.5 accounts for a
highly informative marker, 0.5 > PIC > 0.25 for

Accession

SSR

Allele (in bp)

Freq (%)

Svevo

Xgwml26

203

66.7

Svevo

Xgwml26

212

16.7

Svevo

Xgwml038

235

4.2

Svevo

Xgwml038

252

95.8

Flaminio

Bare 174

216

Graziella Ra

Xgwm750

249

9.1

Cappelli

Xgwm750

236

33.3

Cappelli

DuPw2 1 7

242

8.3

Grazia

Xgwml038

241

4.2

Grazia

Xgwml038

254

12.5

Grazia

Xgwml038

274

4.2

Grazia

DuPw217

232

100

Table 5. Unique alleles observed by SSR molecular markers. Rare
(frequency < 5%) and diagnostic alleles (frequency = 100%) are in bold.

an informative marker, and PIC < 0.25 for a
slightly informative marker (Botstein et al.,
1980), PIC values suggest that SSRs employed in
the present study resulted adequate and efficient.
With reference to the percentage of polymorphism
within each accession, observed values ranged
between 0% (Kamut) and 57.14% (Svevo and
Graziella Ra), going through 14.29% (Flaminio
and Grazia) and 28.87% (Cappelli), with an
average value of 28.57%. Based on SSR markers
herein reported along with the limited number of
accessions under investigation, Table 5 sum-
marizes private alleles observed in this study,
which may be used as a simple indirect measure

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 79

of genetic diversity. As shown, Grazia and Svevo
have the greatest number (four) of accession-
specific alleles; moreover, in Grazia the 232 bp
allele is monomorphic and hence could be
considered as diagnostic for the identification of
the variety; private alleles were observed in
nearly all the accessions, though three of them
were rare, with a percentage below 5%.

Average heterozygosities for AFLPs and SSRs
were not significantly different ( t test, p > 0.05).

Cluster analysis

Genetic distance was calculated using Nei’s
index. Cluster analysis applied to genetic distance
matrices produced the phenetic diagrams shown
in figures 2a and 2b. In both cases, Kamut and
Graziella Ra resulted very similar.

For both AFLPs and SSRs, patterns of PC A
revealed by the first two principal coordinate
axes accounted for the most of the variation in
the data, and so only the first two dimensions
were plotted in this paper. With reference to
pairwise individual genetic distance matrices, the
first two axes accounted for 63.15% (38.56% and
24.59%) of the AFLPs and 64.42% (42.26% and
22.16%) of the SSRs variation (Figs. 3a and 3b);
taking into account PCA of genetic distances
among accessions, the first two axes explained
58.03% (34.95% and 23.08%) of the AFLPs and
61.60% (36.11% and 25.49%) of the SSRs
variation. As shown in figures 3c and 3d, a high
degree of similarity between Graziella Ra and
Kamut was confirmed also by PCA.

Analysis of molecular variance (AMOVA)

Analysis of molecular variance partitioned the
total genetic variance into variance among
populations and within population. For AFLPs,
total variance was partitioned into 80% (variance
among populations) and 20% (within population)
(Fig. 4a); for SSRs, into 73% (among populations)
and 27% (within population) (Fig. 4b).

Correlation between AFLPs and SSRs

A strong correlation (r 2 = 0.92) between AFLP
and SSR population data matrices was obtained
by the Mantel test (Fig. 5). This finding suggests
that both types of molecular markers detected

highly congruent patterns of genetic diversity, at
the accession level, showing nearly similar
efficiency. In fact, AFLP and SSR average
heterozygosities were not significantly different
and observed values of MI or polymorphism
levels were in line with distinctive nature of these
markers. In particular, a higher MI for AFLPs
(0.69 vs\ 0.26) was the result of a higher
multiplex ratio component, due to the
simultaneous detection of several polymorphic
markers per single reaction. On the contrary, a
lower number of total bands was obtained for
SSRs, but all of these were polymorphic, thus
giving a higher average percentage of
polymorphism (28.57% vs. 12.77%) and
providing higher genetic diversity within a given
accession and lower genetic differentiation
among accessions than AFLP markers, which
was confirmed by AMOVA results as well.

A-gliadin gene

A-gliadin is a very important storage protein
widely studied for its implication in coeliac disease
(i.e. Koning, 2005; Gregorini et al., 2009 and
references therein). In this study molecular analysis
of the a- gliadin gene sequence was employed
either to analyse diversity at the gene level or to
provide a possible reconstruction of phylogenetic
relationships among wheats under study.

A-gliadin gene complete sequences obtained
in this study are available at GenBank as
GQ999807 (Cappelli, 903 bp), GQ999809
(Flaminio, 942 bp), GQ999811 (Grazia, 963
bp), GQ999813 (Graziella Ra, 909 bp),
GQ999815 (Kamut, 942 bp), GQ999817
(Svevo, 942 bp). Sequences alignment showed
78 variable sites, 79 mutations (S = 78, Eta =
79) and 75 insertions/deletions. Nucleotide
diversity ( 71 ) was 0.032 ± 0.011 and 0.033 when
corrected according to Jukes and Cantor ( 7 c JC ).
The average number of nucleotide differences
(k) was 28.867. Assessed mean sequence
identity was 91.5%; in particular, a-gliadin
genes from Graziella Ra and Kamut were 95%
identical. Deduced a-gliadin protein sequences
showed a mean identity of 89.4%; a-gliadins
from Graziella Ra and Kamut were 94.3%
identical. Maximum likelihood and Bayesian
Inference phylogenetic reconstructions
produced nearly identical results. ML and BI

M. Stella Colomba & Armando Gregorini

2a 2b

Figure 2. 2a. Dendrograms of the six wheat accessions based on Nei’s genetic distance calculated using 137 amplified fragment length
polymorphisms (AFLPs); 2b. Dendrograms of the six wheat accessions based on Nei’s genetic distance calculated using seven simple
sequence repeats (SSRs). 1, Svevo; 2, Flaminio; 3, Kamut; 4, Graziella Ra; 5, Cappelli; 6, Grazia. Bootstrap supporting values (1,000
replicates) are reported on the nodes.

Principal Coordinates

4 Svevo
■ Flaminio
a Kamut
Graziella
4 Cappelli
Grazia

Principal Coordinates

■ ■

■ ■ ,

•

♦♦ ♦

■ ■

. ■ •

• A *

•

* a*

Coord. 1

4 Svevo
■ Flaminio
A Kamut
4 Graziella
4 Cappelli
Grazia

Principal Coordinates

4 .Flam iruo

4 Cabpelli

4 Grazia

4 Svevo

Coord. 1

4 Cappelli

4 Svevo

♦ Graziella

« Kamut

* Flam inio

* Grazia

Coord. 1

Figure 3. Principal Component Analysis (PCA) plots of the first two axes based on genetic distance matrices among individuals for AFLP (3 a)
and SSR (3b) datasets; PCA plots of the first two axes based on genetic distance matrices among accessions for AFLP (3c) and SSR (3d)
datasets.

4a 4b

Percentages of Molecular Variance

Within Pops

VWthin Pops

20%

27%

N- ^Among Pops

Among Pops

73%

80%

Figure 4. Results of Analysis of Molecular variance (AMOVA) for the total AFLPs (4a) and SSRs (4b) showing the percentage of variation
among and within accessions.

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 81

PhiPTP SSRs vs PhiPTP AFLPS

PhiPTP SSRs

Figure 5. Output of Mantel test comparing the AFLP and SSR genetic distance matrices at accession level.

CappelliL

100

Taestiv

Tdicoccoides

100

GraziaL

- SvevoL

FlaminioL

KamutL

GraziellaL

GraziaL

FlaminioL

KamutL

SvevoL

GraziellaL

Figure 6. 6a. 50% majority rule Maximum Likelihood consensus tree inferred from the a-gliadin gene sequence alignment. Numbers above
branches represent bootstrap values (100 replicates). 6b. Bayesian consensus tree inferred from the a-gliadin gene sequence alignment. Numbers
above branches represent Bayesian posterior probabilities. T. aestivum and T. dicoccoides were employed as outgroups to root the trees.

M. Stella Colomba & Armando Gregorini

Common wheat *

Kamut

Graziella Ra

Water

11.5%

9.8%

10.8%

Protein**

14%

19.6%

11.80%

Total lipid (fat)

1.9%

2.6%

2.91%

Carbohydrate

72.7%

68.2%

61.23%

Crude fiber

2.1%

1.8%

2.7%

Ash

1.66%

1.82%

2.02%

MINERALS (mg/lOOg)

Calcium

31.2

Iron

3.9

4.2

2.5

Magnesium

117

153

85.3

Phosphorus

396

411

450

Potassium

400

446

379.1

Sodium

2.0

3.8

5.8

Zinc

3.2

4.3

Copper

0.44

0.46

0.5

Manganese

3.8

3.2

2.2

Selenium (mg/kg)

1.6-7

VITAMINS (mg/lOOg)

Thiamine (Bl)

0.42

0.45

>0.05

Riboflavin (B2)

0.11

0.12

0.02

Niacin

5.31

5.54

7.83

Panthotenic acid

0.91

0.23

0.04

Vitamin B6

0.35

0.08

0.94

Folacin

0.0405

0.0375

0.031

Vitamin E

1.2

1.7

0.43

AMINO ACIDS (g/100g)

Tryptophan

0.194

0.117

Threonine

0.403

0.540

0.42

Isoleucine

0.630

0.600

0.78

Leucine

0.964

1.23

0.86

Lysine

0.361

0.440

0.34

Methionine

0.222

0.250

Cystine

0.348

0.58

Phenylalanine

0.675

0.85

0.36

Tyrosine

0.404

0.430

0.21

Valine

0.624

0.800

0.46

Arginine

0.610

0.860

0.69

Histidine

0.321

0.430

0.29

Alanine

0.491

0.630

0.45

Aspartic acid

0.700

0.980

0.65

Glutamic acid

4.68

5.97

4.09

Glycine

0.560

0.650

0.47

Proline

1.50

1.44

1.31

Serine

0.662

0.930

0.51

an average number for all the wheats in the USD A report was used; **European scale on dry matter

Table 6. Nutritional values for common wheat*, Kamut® brand wheat (both available at www. kamut.com) and
Graziella Ra wheat (present paper).

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 83

consensus trees (Figs. 6a and 6b) showed that
molecular clustering disagreed with mor-
phological clustering, in fact, contrary to AFLPs
and SSRs, phylogenetic analyses of a-gliadin
gene sequences showed Graziella Ra and
Kamut in separate clusters. This finding not
only confirms that the two wheats are related
but also supports the hypothesis that, although
being similar - at least in the little part of the
genome investigated by molecular markers
employed in this study - Graziella Ra and
Kamut may be considered distinct accessions.

Nutritional quality

Given that all parameters linked to
nutritional qualities are affected by the
environment and that we compared Graziella
Ra (analysed in triplicates) with Kamut (whose
nutritional quality is reported in the Kamut web
site, without any descriptions of how each
parameter was assessed) a real comparison
(including statistics) was not possible.
Nevertheless, it is noticeable that all values of
dietary components of Graziella Ra are in line
with mean values reported for Kamut and other
commercially available durum wheats (Table
6). Hence, our results corroborate the idea that
Graziella Ra may be considered an accession
distinct from Kamut endowed by appreciable
levels of genetic diversity and medium-high
nutritional qualities.

ACKNOWLEDGEMENTS

We are grateful to R Bianchi for figure 1. This
research was supported by CIPE 20/04 - DGR
438/2005 to M.S. Colomba and A. Gregorini.

REFERENCES

Botstein D., White R.L., Skolnick M. & Davis R.W., 1980.
Construction of a genetic linkage map in man using
restriction fragment length polymorphisms. The
American Journal of Human Genetics, 32: 314-331.
Boutin-Ganache I., Raposo M., Raymond M. & Deschepper
C.F., 2001. M13-tailed primers improve the readability
and usability of microsatellite analyses performed with
two different allele-sizing methods. Biotechniques, 3 1 :
24-28.

Drummond A.J. & Rambaut A., 2007. BEAST: Bayesian
evolutionary analysis by sampling trees. BMC
Evolutionary Biology, 7: 1214-1257.

Doyle J.J. & Doyle J.L., 1990. Isolation of plant DNA from
fresh tissue. Focus, 12: 13-15.

Fukatsu E., Isoda K., Hirao T., Takahashi M. & Watanabe
A., 2005. Development and characterization of simple
sequence repeat DNA markers for Zelkova serrata.
Molecular Ecology Notes, 5: 378-380.

Gregorini A., Colomba M.S., Ellis H.J. & Ciclitira P.J.,
2009. Immunogenicity characterization of two ancient
wheat a-gliadin peptides related to coeliac disease.
Nutrients, 1: 276-290.

Hall T.A., 1999. BioEdit: a user-friendly biological
sequence alignment editor and analysis program for
Windows 95/98/NT. Nucleic Acids Symposium Series,
41: 95-98.

Koning F., 2005. Celiac disease: caught between a rock and
a hard place. Gastroenterology, 129: 1294-1301.

Librado R & Rozas J., 2009. DnaSP v5: a software for
comprehensive analysis of DNA polymorphism data.
Bioinformatics, 25: 1451-1452.

Miller M.P., 1997. Tools for population genetic analyses
(TFPGA 1.3): A windows program for the analysis of
allozyme and molecular population genetic data.
Available at http://www.marksgeneticsoftware.net/.

Nei M., 1978. Estimation of average heterozygosity and
genetic distance from a small number of individuals.
Genetics, 89: 583-590.

Peakall R. & Smouse P.E., 2006. GenAlEx6: genetic
analysis in Excel. Population genetic software for
teaching and research. Molecular Ecology Notes, 6:
288-295.

Powell W., Morgante M., Andre C., Hanafey M., Vogel J.,
Tingey S. & Rafalsky A., 1996. The comparison of
RFLP, RAPD, AFLP and SSR (microsatellite) markers
for germplasm analysis. Molecular Breeding, 2: 225-
238.

Schuelke M., 2000. An economic method for the fluorescent
labelling ofPCR fragments. Nature Biotechnology, 18:
233-234.

Shapiro B., Rambaut A. & Drummond A.J. , 2006. Choosing
appropriate substitution models for the phylogenetic
analysis of protein-coding sequences. Molecular
Biology and Evolution, 22: 7-9.

Sneath P.H.A. & Solcal R.R., 1973. Numerical taxonomy -
the principles and practice of numerical classification.
WH Freeman, San Francisco.

Stallknecht G.F., Gilbertson K.M. & Ranney J.E., 1996.
Alternative wheat cereals as food grains: Einkorn,
Emmer, Spelt, Kamut, and Triticale. In: Janick J (ed.)
Progress in new crops, ASHS Press, Alexandria, VA, pp.
156-170.

Stephenson P., Glenn B., Kirby J., Collins A., Devosk K.,
Busso C. & Gale M., 1998. Fifty new microsatellite loci
for the wheat genetic map. Theoretical and Applied
Genetics, 97: 946-949.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. &
Kumar S., 2011. MEGA5: Molecular Evolutionary
Genetics Analysis using Maximum Likelihood,

M. Stella Colomba & Armando Gregorini

Evolutionary Distance, and Maximum Parsimony
Methods. Molecular Biology and Evolution, doi:
10.1093/molbev/msrl21. First published online: May 4
2011 [Epub ahead of print], pdf available at
http://www.kumarlab.net/publications.

Von Buren M., 2001. Polymorphism in two homeologous
gamma-gliadin genes and the evolution of cultivated

wheat. Genetic Resources and Crop Evolution, 48:
205-220.

Vos P., Elogers R., Bleeker M., Reijans M., van der Lee
T.H., Hornes M., Frijters A., Pot J., Peleman J., Kuiper
M. & Zabeau M., 1995. AFLP: a new technique for
DNA fingerprinting. Nucleic Acids Research, 23:
4407-4414.

Biodiversity Journal, 2011, 2 (2): 85-88

Description of three new species of longhorn beetles (Coleoptera,
Cerambycidae) from Turkey and Syria

Gianfranco Sama 1 & Pierpaolo Rapuzzi 2

1 Via Raffaello Sanzio 84 - 47023 Cesena (FC), Italy. E-mail: francosama@gmail.com

2 Via Cialla, 48 - 33040 Prepotto (UD), Italy. E-mail: info@ronchidicialla.it

ABSTRACT The following new taxa are described and illustrated: Chlorophorus grosser i n. sp. from Southern and Eastern
Turkey, close to C. adelii Holzschuh, 1974 from Western Iran; Chlorophorus oezdikmeni n. sp. from Turkey
compared to C. hungaricus Seidlitz, 1891 and Leiopus wrzecionkoi n. sp. from North-Eastern Syria, compared
to L. syriacus (Ganglbauer, 1884).

KEY WORDS Cerambycidae, longhorn beetles, new species, Turkey, Syria.

Received 04.05.2011; accepted 24.05.2011; printed 30.06.2011

INTRODUCTION

Thanks to the courtesy of some colleagues we
were able to study the Cerambycidae collected
by them during their trips in Near Orient,
including new taxa which have recently been
published by ourselves (Rapuzzi & Sama, 2010;
Rapuzzi et al., 2011). The aim of this article is to
describe two new species belonging to the genus
Chlorophorus Chevrolat, 1863 (Cerambycidae,
Clytini) discovered in Turkey by our colleague
Semra Turgut (entomologist at the Gazi
University, Ankara) and by the Czech
entomologist Walter Grosser respectively, as
well as a new species of Leiopus Audinet-
Serville, 1835 (Cerambycidae, Acanthocinini)
collected by Antonin Wrzecionko.

Chlorophorus grossed n. sp.

Material examined. Holotype female (Fig.
1): Turkey, Sirnak prov.: Mesindagi geg., 25 Km
NW Sirnak, 1600 m, 37°67’N 42°31’E,
23 .VI. 20 10, Walter Grosser legit; paratypes: 1
male (not available for detailed study): same data
as the holotype; 1 female: Hakkari prov., 25 Km
E Giizeldere, 37°32’N 43°49’E, 930 m,

22. VI. 20 10, Walter Grosser legit; 7 males and 8
females (immature adults just emerged ex larvae
and pupae): same locality as the holotype,
15.V.2011, ex larvae and pupae in Quercus sp., R
Rapuzzi & G. Sama legit. Holotype in P. Rapuzzi
collection; paratypes in W. Grosser, P. Rapuzzi,
G. Sama and J. Vofiselc collections.

Description of the holotype. body length
9 mm. Integument reddish brown, the apical
third of elytra, the hind legs and the ventral
face of body black-brown. Front with a distinct
median groove between the antennal tubercles.
Pronotum strongly globose, as long as wide,
discal surface with quite denser rasp-like
punctures and sparsely clothed with fine
greyish recumbent pubescence; this
pubescence is chiefly condensed at sides as
well as on front and, more widely, on basal
margin. Scutellum densely clothed with white
pubescence. Elytra moderately short and wide,
apex truncate with a small tooth on the outer
side; surface predominantly reddish-brown
(black-brown on apical third only) with a
pattern of distinctly contrasting stripes of
white pubescence (see Fig. 1); discal surface
very densely and finely punctate and clothed
with short recumbent black pubescence.

G. Sam a & P. Rapuzzi

Figure 1. Chlorophorus grosseri n. sp. holotype female.

Ventral side of body brownish-black, meso-
and metepisterna, base of the metasternum and
base of the first and second visible sternites
densely clothed with contrasting white
pubescence. Antennae reddish-brown, short,
hardly extending to the middle of elytra, third
to fifth joints sparsely clothed with erect hairs
on latero-ventral surface. Front legs reddish
brown, middle femora with claws blackish,
hind legs black.

Variability. The male (Fig. 2) differs from
the female by its more elongate pronotum,
similar to C. adelii Holzschuh, 1974; the female
paratype does not show difference except the
length, 10 mm.

Etimology. the new species is named in
honour of our friend Walter Grosser from Czech
Republic, who collected the first specimens.

Figure 2. Chlorophorus grosseri n. sp. paratype male.

Distribution and ecology. At present, the
new species is known from Southern and Eastern
Turkey. Larval bionomics similar to C. adelii , C.
ringenbachi Sama, 2004 from Libya and C.
favieri Fairmaire, 1873 from Morocco;
oviposition takes place on dead apical part of
small living branches or stumps (2-5 cm in
diameter) cut by people the previous year or
girdled by other Cerambycidae.

Comparative notes. C. grosseri n. sp. is
closely related to C. adelii Holzschuh, 1974 from
Zagros Mountains (western Iran) (male and
female paratypes examined). This latter can be
easily distinguished as follows: pronotum, in both
sexes, longer than wide, sub parallel-sided, elytral
integument predominantly black, brown on basal
third only, antennae somewhat more robust, with
proximal segments in average more elongate and
distal segments evidently shortened.

Description of three new species of longhorn beetles (Coleoptera, Cerambycidae) from Turkey and Syria

Cholorophorus oezdikmeni n. sp.

Material examined. Holotype male (Fig. 3)
and three paratypes males: Karaman Marash
prov., Andirin, 15. VII. 2003, S. Turgut legit.
Holotype in P. Rapuzzi collection; paratypes in
H. Ozdikmen (Gazi University, Ankara) and G.
Sama collections.

Description of the holotype. Body length
10 mm, entirely black except two dark-red
spots on the pronotal disc and the elytral
pattern. Front subquadrate with an unpunctate
median area with a thin median groove.
Pronotum as long as wide, globose, densely
clothed with irregular vermiculate punctures
and long white erect hairs, entirely black
except one small, indistinct reddish spot on
each side of the middle of the disc. Scutellum
rounded, bordered with dense white
pubescence. Elytra sub parallel-sided, black-
brown, clothed on basal third with numerous
erect white hairs and a pattern of whitish
pubescence similar to C. hungaricus Seidlitz,
1891. Antennae short, hardly exceeding the
middle of elytra.

Variability. Female unknown. Paratypes
males: length varies from 9 to 12 mm; the red
pronotal spots varies in size and shape: they can
be very reduced like in the holotype, fused in a
discal “M” shaped drawing or extended as a thin
oblique line on each side of the disc.

Etimology. we are pleased to dedicate the
new species to our friend and colleague Huseyin
Ozdikmen (Gazi University, Ankara), for the
authorisation to study the material belonging to
his collection and for various help during our
research on Turkish Cerambycidae.

Distribution and ecology. C. oezdikmeni n.
sp. was collected in South-Western Turkey.
Larval biology is unknown.

Comparative notes. C. oezdikmeni n. sp.
belongs to the C. trifasciatus (Fabricius, 1781)
species group; because of its pronotum and
elytral base clothed with long erect hairs it is
similar to Chlorophorus hungaricus Seidlitz,
1891, from which it can be immediately
distinguished by its almost entirely black
pronotum.

Leiopus wrzecionkoi n. sp.

Material examined. Holotypus male (Fig.
4): Syria, Slinfah, Jabal An Nusayriyah [written
as “Jabal An Nusaynyah” on labels], 1,300-1,800
m, 18.IV.2010, ex larva from Alnus sp., A.
Wrzecionlco legit; paratypes: eighteen males,
five females: same data as the holotype; sixteen
males, two females: Syria, Jabal An Nusayryah,
Slinfah, 1,300-1,800 m, 27.IV.2008, A.
Wrzecionko legit; one male: Slinfah; “the ridge
above the town”, 25.V.2005, D. Sane legit, “The
imago was beaten from the dry oak twig attached
to the living tree”. Holotype in P. Rapuzzi
collection, paratypes in P. Rapuzzi, G. Sama, D.
Sane, A. Wrzecionko and Z. Kostal collections.

Description of the holotype. Body length
8 mm. Integument black, pronotum and elytra
densely clothed with greyish recumbent
pubescence, third to tenth antennal joints more
or less widely reddish at base. Head black with
front sparsely clothed with white hairs, vertex
with a deep impression between the antennal
insertions. Pronotum transverse with an acute
short tooth directed backward on each side just
behind the middle, discal surface marked with
numerous spots of black pubescence. Elytra
short, somewhat flattened chiefly toward the
apex and the sides, attenuate apically; discal
surface clothed with short cinereous
pubescence not masking the ground punctation
and marked with a distinctly contrasting
pattern consisting of numerous black round
spots (each one originating a very short oblique
seta) irregularly distributed on the basal and the
apical quarter and along the suture, a median
large black band narrowly interrupted near the
suture and a longitudinal band entirely
covering the epipleurae and the lateral margin
of elytra. Legs and tarsi black, sparsely clothed
with whitish pubescence locally condensed
forming a median ring on tibiae and tarsi.
Antennae long, exceeding the elytral apices
with six segments.

Variability. The specimens we could study
show a range of length between 9 to 11 mm.
Pronotal and elytral black spots and stripes are
sometimes more extended or reduced like in
other species of the genus.

G. Sam a & P. Rapuzzi

Figure 3. Chlorophorus oezdikmeni n. sp. holotype male.

Etymology. We are pleased to dedicate this
new species to our friend Antonin Wrzecionko
who discovered it.

Distribution and ecology. L. wrzecionkoi n.
sp. was collected from North-Eastern Syria. Most
specimens were collected in dead branches of Alnus
sp. or by beating dried oak twigs.

Comparative notes. Despite its resemblance
to L. punctulatus (Paykull, 1800) from Europe,
due to its black body and its elytral pattern,
Leiopus wrzecionkoi n. sp. belongs to the L.
syriacus (Ganglbauer, 1884) species group. It is
chiefly similar to L. syriacus abieticola Sama &
Rapuzzi, 2010 from southern Turkey which can
be distinguished from the new species by the
integument constantly light-brown instead of
piceous-black and the elytra distinctly convex.

ACKNOWLEDGEMENTS

We wish to thank our colleagues and friends
Antonin Wrzecionko (Horni Sucha, Czech
Republic), Walter Grosser (Opava, Czech
Republic), Huseyin Ozdikmen and Semra
Turgut (Gazi Universitesi, Fen-Edebiyat
Fakultesi, Biyoloji Bolumii, Ankara) who
kindly sent material of their collections for
identification.

REFERENCES

Rapuzzi P. & Sama G., 2010. Description of new
Cerambycidae from Greece, Turkey, Northern Syria and
China. Quaderno di Studi e Notizie di Storia Naturale
della Romagna, 29 (2009): 181-188.

Rapuzzi P., Sama G. & Tichy T., 2011. Description of a new
species of Poecilium Fairmaire, 1864 from Syria. Munis
Entomology & Zoology, 6: 673-675.

Biodiversity Journal, 2011, 2 (2): 89-96

Does diet in lacertid lizards reflect prey availability? Evidence for
selective predation in the Aeolian wall lizard, Podarcis raffone
(Mertens, 1952) (Reptilia, Lacertidae)

Pietro Lo Cascio 1 & Massimo Capula 2

1 Associazione Nesos, via Vittorio Emanuele 24, 98055 Lipari (ME), Italy; e-mail: plocascio@nesos.org.
2 Museo Civico di Zoologia, Via Aldrovandi 18, 00197 Roma, Italy; e-mail: massimo.capula@comune.roma.it.

ABSTRACT In this paper the invertebrate fauna occurring on Scoglio Faraglione, a tiny Aeolian island (Aeolian
Archipelago, NE Sicily) inhabited by a population of the critically endangered lacertid lizard Podarcis raffonei
(Mertens, 1952), was censused at different seasons and the resulting data were then compared with data
obtained analysing prey composition and prey abundance in the diet of the lizards occurring on the same islet.
The diet of Podarcis raffonei was mainly based on insects and other arthropods. The results indicate that diet
composition is not directly influenced by prey availability and temporal prey abundance, and that there is
strong evidence indicating selective predation. Lizards prey upon a number of arthropod categories fewer than
that recorded in field. Some invertebrate taxa (e.g. Diptera and Gastropoda) are really less attractive for lizards
and are rarely preyed or not preyed at all despite their spatial and/or temporal abundance. This suggests that
Podarcis raffonei is able to operate a hierarchical choice within the range of prey items constituting its prey
spectrum, probably through the ability to discriminate between prey chemicals or visually oriented predation.

KEY WORDS Podarcis raffonei; Lacertidae; predator selectivity; prey availability; feeding behavior; Aeolian Islands.

Received 10.05.2011; accepted 30.05.2011; printed 30.06.2011

INTRODUCTION

Most lacertid lizards of the Mediterranean area
are known to be active foragers and generalist
predators (see e.g. Podarcis siculus : Kabisch &
Engelmann, 1969; Perez-Mellado & Corti,
1993). They prey on a wide variety of
invertebrates, mainly on arthropods (e.g.
Arachnidae, Insects larvae, Diptera, Coleoptera,
Heteroptera, Hymenoptera, Orthoptera, Gastropoda)
(see e.g. Capula et al., 1993; Rugiero, 1994;
Corti & Lo Cascio, 2002; Bonacci et al., 2008;
Corti et al., 2011), while occasionally small
vertebrates and vegetal matter can be also eaten
(Sorci, 1990; Sicilia et al., 2001; Capula &
Aloise, in press). The feeding behavior of some
lacertid lizards seems to be opportunistic, as
indicated by the consumption of different preys
in different habitats and/or geographic areas by
the same species. However, few data are

available on predator selectivity and prey choice
as well as prey availability in the field (see e.g.
Heulin, 1986; Dominguez & Salvador, 1990;
Maragou et al., 1996; Adamopoulou & Legakis,
2002; Perez-Mellado et al., 2003; Bonacci et al.,
2008). Hence special attention should be devoted
to study selective predation and how diets of
lacertid lizards relate to changes in the
abundance of their prey, especially in micro-
insular habitats, which are generally affected by
extreme poorness of trophic resources and where
lizards are usually assumed to be adapted to
exploit the widest range of preys, alternatively
adopting opportunistic or generalist feeding
strategies (Perez-Mellado & Corti, 1993;
Carretero, 2004; Luiselli, 2008).

Podarcis raffonei (Mertens, 1952) is a
lacertid lizard endemic to the Aeolian
Archipelago (NE Sicily), where it occurs with
four relict populations on three tiny islets

P. Lo Cascio & M. Capula

(Strombolicchio, Scoglio Faraglione, La Canna)
and on a very small area of Vulcano Island (Lo
Cascio, 2010; Capula & Lo Cascio, 2011). The
conservation status of this species has recently
received attention because it is likely threatened
with extinction (Capula et al., 2002; Capula,
2006; Lo Cascio, 2010; Capula & Lo Cascio,
2011). As most of Mediterranean island lacertid
lizards (see e.g. Perez-Mellado & Corti, 1993;
Van Damme, 1999), the diet of the Aeolian wall
lizard is known to be based mainly on insects and
other arthropods, but also includes variable
percentages of vegetal matter (Luiselli et al.,
2004; Lo Cascio, 2006; Capula & Lo Cascio,
2011). However, no data are available concerning
prey choice and prey availability for the species.

The main aim of this study was to explore
whether P. raffonei selects preys in accordance
with their availability in the environment. To test
this, the invertebrate fauna occurring on Scoglio
Faraglione, which is an Aeolian tiny islet
inhabited by P. raffonei , was censused at
different seasons, and the resulting data were
then compared with data obtained analysing prey
composition and prey abundance in the diet of
the lizards occurring on the same islet.

MATERIALS AND METHODS
Study area

Scoglio Faraglione (38°34’77” N - 14 o 48’08”
E of Greenwich) is an uninhabited tiny islet of
the Aeolian Archipelago. It lies in the Pollara
Bay, 300 m off the western coast of Salina Island.
The surface is 5,765 m 2 and the maximum
altitude is 33 m a.s.l. The islet is composed by
basaltic lavas, and was definitively isolated from
the main island about 15,000-10,000 years ago,
due to erosive processes, changes in eustatic sea
level which occurred after the Last Glacial
Maximum, and catastrophic eruption of the
Pollara crater (13,000 yrs B.P.), which involved
most part of the western slope of Salina Island
and destroyed its original extension (Calanchi et
al., 2007). Average annual rainfall (on the main
island) is about 600 mm, with a peak in
December and a minimum in July; average
temperatures range from 13.3 °C (January) to
29.8 °C (August). The top of the Scoglio
Faraglione islet is covered by dense shrub

vegetation, which is characterized by the
occurrence of Senecio cineraria ssp. bicolor ,
Dianthus rupicola ssp. aeolicus , and Lotus
cytisoides , while the rocky slopes of the basal
belt harbour halo-chasmophytic plant communities
dominated by Limonium minutiflonim and Inula
crithmoides. Apart from the lizards, the only
vertebrates that inhabit the islet are the Moorish
gecko, Tarentola mauritanica , a small colony of
Yellow-legged gull, Larus michahellis, and few
pairs of other seabird species. As to the
invertebrate fauna of Scoglio Faraglione, a non-
exhaustive list is given by Lo Cascio & Navarra
(2003).

Study lizards

The population of Podarcis raffonei
occurring on Scoglio Faraglione islet is
characterized by medium-sized lizards with
brownish dorsal coloration and ventral parts
pearl-grey; it is referred to the ssp. alvearioi and
is morphologically relatively differentiated from
the populations of the same subspecies occurring
on La Canna islet and Vulcano Island (Capula et
al., 2009). Lizards are observed especially on the
top of the islet, and are active mainly from March
to November; however, occasional activity may
be recorded also in sunny days during Winter.
The activity pattern is unimodal in Spring and
Autumn, and bimodal in Summer (Lo Cascio,
2006). The density of lizards ranges from 0.18 to
0.37 individuals/m 2 , and the estimated
population size is about 300 individuals (Lo
Cascio, 2006; Capula & Lo Cascio, 2011).

Sampling and taxonomic identification

Field sampling was carried out during three
visits in May, July, and October 2005. For the
invertebrates, two sampling areas per session
were selected on the top of the islet; each was 1
x 1 m sized. A better procedure would have
required to seal completely the sample-area,
using a biocenometer of 1 m 3 (see Perez-Mellado
et al., 2003), in order to collect all the animals
occurring on soil, on vegetation and aerial parts
inside the box. However, taking into account the
fragility of the studied ecosystem, the peculiar
vegetation pattern, and the morphology of the
islet, a different methodological protocol was

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 91

adopted, following some of the proposals
summarized by Disney (1986) and Ausden
(1996). Into each sampling area invertebrates
were collected i) by direct searching on substrate,
under stones and on plants, using a pooter; ii)
taking samples of soil and plant debris up to 10-
15 cm depth, which were then examined and
hand sorted in laboratory; iii) by sweep netting
and beating on foliage; also, a plastic yellow
Moericke trap (40 cm of diameter, filled by water
and detergent to decrease the surface tension)
was placed at the same level of the higher layer
of vegetation for 5-6 hours, corresponding to the
timeframe of lizards’ activity. All the collected
specimens were preserved in alcohol, except for
Coleoptera, which were stored as dry material in
the collection of one of the authors (PLC) and
used for further studies. The taxonomic
identification of the invertebrate fauna samples
collected was performed comparing material
preserved in the entomological collections of the
Zoological Museum of Florence “La Specola”.
In the present analysis, the representatives of the
invertebrate fauna were identified to OTUs
(Operative Taxonomic Units: see Sneath &
Sokal, 1973; Carretero, 2004), approximated to
class/order level; the identification to OTUs at
the family level was only performed for
Coleoptera Melyridae and Hymenoptera
Formicidae, because of the importance of these
taxa in the diet of the local population of P.
raffonei (Lo Cascio, 2006). The following
abbreviations were used to indicate the OTUs in
the text and figures: AC A, Acarina; ARA,
Araneae; ART, unidentified Arthropoda; CHI,
Chilopoda; CLB, Collembola; COL, Coleoptera;
DPL, Diplopoda; DPT, Diptera; FOR,
Hymenoptera Formicidae; GAS, Gastropoda;
HET, Heteroptera; HOM, Homoptera; HYM,
Hymenoptera; ISO, Crustacea Isopoda; LAR,
insect larvae; LEP, Lepidoptera; MEL,
Coleoptera Melyridae; NEM, Nematoda; NEU,
Neuroptera; ODO, Odonata; PSE,
Pseudoscorpiones.

Invertebrate fauna biomass was assessed
using the following protocol: to each OTU was
assigned a value (ranging from 0 to 10) which
was estimated on the basis of its average size.
For instance, the coleopterans occurring on the
islet include about ten species, whose length
ranges from 4 to 15 mm; the average size

calculated for that taxon was 5.5. The value
assigned to each OTU was then multiplied with
the total number of specimens collected in the
field for each OTU. The diet of lizards (adult
individuals only; snout- vent length (SVL) > 40
mm) was studied on the basis of faecal pellets
analysis. Faecal pellets were obtained from
individuals captured in the field; after faecal
pellets collecting, lizards were released in the site
of capture (see Lo Cascio, 2006). Faecal contents
were examined in the laboratory under
stereoscope (10-40 X); item counting was based
on the analysis of cephalic capsulae, wings, and
legs, following the minimum numbers criterion
by sample. The invertebrate remains were
identified to OTUs at class/order/family level, as
above mentioned.

Statistical analysis

The diversity of prey item OTUs and
invertebrate fauna OTUs collected in the field
was calculated using Shannon Index (Shannon,
1948; see also Chao & Shen, 2003). Statistical
analyses were performed using SPSS 0 version
11.5 for Windows PC package, with alpha set at
5% and all test being two tailed.

RESULTS

The diet of lizards was composed mainly by
arthropods, although plant matter was also
recorded. A total number of 95 remains of
arthropod preys were obtained from 34 faecal
pellets of lizards at the study area. The
composition and abundance of prey items and
their temporal variations are summarized in
Table 1. The identifiable preys (i.p.) were 2.94 ±
1.87 per faecal pellet; the i.p. number differed
significantly among seasons (May: 4.18 ± 2.08;
July: 2.75 ± 1.98; October: 1.92 ± 0.90; F 20g =
5.22, P = 0.01). The prey spectrum also varied in
a statistically significant way among seasons (x 2
= 47.59, df = 26, P = 0.006), and the diet of lizards
was more diversified in October (77 = 2.146) and
May (// = 2.058) than in July (// = 1.898);
however, in the latter comparison prey diversity
was estimated analysing total amount of
consumed preys only, without considering their
seasonal variation. Overall, N = 696 invertebrates

P. Lo Cascio & M. Capula

belonging to 21 different OTUs were collected
into the sampling areas (see Fig. 1). Sixty seven
percent of the OTUs collected in the sampling
areas (14 out of 21) were found as prey items of
lizards (see Table 1). Formicidae (FOR),
Coleoptera (COL+MEL), Hymenoptera (HYM)
and Diplopoda (DPL) accounted for the great
part of the dietary spectrum. FOR, HYM, ART
and HET were found in the diet of lizards from
May to October, while DPL were found in July
and October, and COL+MEL in May and July
only. The other preyed OTUs (ARA, DPT, GAS,
HOM, ISO, LAR, PSE) occurred with low
frequency in the diet of lizards. The following
OTUs were never found as prey items: AC A,
CLB, CHI, LEP, NEM, NEU, ODO. Among the
highly preyed taxa, Coleptera and Heteroptera
were represented in the diet with a percentage
higher than that observed in the field (COL, diet:
12.6%, field: 7.8%; HET, diet: 4.2%, field:
1.8%). Hymenoptera were represented in the diet
with a percentage (11.6%) close to that observed
in the field (13.4%), and Formicidae occurred
with relatively high frequency in the diet of
lizards regardless of the season. Some taxa were
represented in the diet with low or very low

frequency despite their spatial/temporal
abundance in the field. This is the case of
Diptera, which constitute the 4.2% of the diet
although representing the 19.5% of the
invertebrate biomass on the islet, and
Gastropoda, which constitute the 1% of the diet
only although being the 5.1% of the invertebrate
biomass at the study area. Moreover, some
invertebrates which are widespread and abundant
in the field, such as e.g. Acarina and Collembola,
were not present at all in the diet of lizards.

To test any relationship between the
biomass of both prey items really hunted by
lizards and potential prey items occurring in
the field, the estimated biomass of the OTUs
constituting the prey spectrum of lizards was
compared with that of the OTUs sampled in the
field. The comparison shows that the two
groups are significantly different to each other
(% 2 = 34.20, df = 13, P = 0.001), thus suggesting
little or no relationship. The estimation of the
Shannon index gives similar values for both
groups (hunted prey items: H s = 2.265;
potential prey items: H = 2.269), indicating a
relatively high amount of diversity within each
group.

Taxon

May

July

October

Araneae

Arthropoda (unidentified)

Coleoptera s.l.

Coleoptera Melyridae

Diptera

Diplopoda

Gastropoda

Heteroptera

Homoptera

Hymenoptera s.l.

Hymenoptera Formicidae

Insect larvae

Isopoda

Pseudoscorpiones

Table 1. Diet composition (in %) of Podarcis raffonei at Scoglio Faraglione Islet during 2005.

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 93

75 n

GAS NEM ISO PSE ARA ACA DPL CHI LAR CLB ODO HOM HET COL MEL LEP NEU DPT HYM FOR

Figure 1. Frequency and estimated biomass of invertebrate fauna at the sampling areas during May (white histograms), July (grey)
and October (black). Above: number of specimens collected in the field; below: estimated biomass of OTUs (see Material and methods
for explanations).

DISCUSSION

This study shows that in P. raffonei diet
compositon is not directly influenced by prey
availability and temporal prey abundance, and
that there is strong evidence indicating selective
predation. These results suggest the occurrence
of a food preference strategy similar to that
observed in some lacertid lizard species (see
e.g. Heulin, 1986; Dominguez & Salvador,
1990; Maragou et al., 1996; Adamopoulou &
Legakis, 2002). Although caution should be
exercised when inferring diet composition by
faecal pellets analysis, as this methodology
probably under-estimates the number of prey
items and results depend on the number of
samples collected and the subjectivity and
taxonomic knowledge of the investigator, our

data indicate that some OTUs are really less
attractive for lizards and are rarely preyed or not
preyed at all despite their spatial and/or
temporal abundance, probably because of prey
chemicals or visual discrimination by lizards
among possible prey items. This is the case of
Diptera and Gastropoda, which were clearly
neglected or rarely preyed by lizards,
regardless of their abundance in the field, and
Acarina and Collembola, which were never
preyed by lizards, possibly because of the very
small size (often less than 1 mm) of these
arthropods, which cannot be considered as
suitable preys for a medium-sized predator
such as Podarcis raffonei (adult SVL of lizards
ranging from ca. 40 to 80 mm).

Based on our results, it can be inferred that
the Aeolian wall lizard is able to operate a

P. Lo Cascio & M. Capula

hierarchical choice within the range of prey
items constituting its prey spectrum, probably
through (i) the ability to discriminate between
prey chemicals, or (ii) visually oriented
predation. For instance, among the 14 OTUs
usually preyed by the Aeolian wall lizard,
Coleptera, Heteroptera, Hymenoptera s.l. and
Hymenoptera Formicidae can be clearly
considered as preferred prey items by the
species. In the case of Formicidae, it must be
noted that myrmecophagy is a well-known
feeding preference habit in island lizard
populations (Perez-Mellado & Corti, 1993;
Adamopoulou et al., 1999; Carretero, 2004;
Bombi et al., 2005; Lo Cascio & Pasta, 2006;
Carretero et al., 2010). Diplopoda, which are
known to produce a wide array of chemical
defenses (see e.g. Blum & Porter Woodring,
1962; Duffey et al., 1977; Eisner et al., 1978;
Kuwahara et al., 2002), apparently should not
be considered as appetible preys by lizards.
However, these arthropods can be found in the
diet of Aeolian wall lizards from July to
October with relatively high frequencies (see
Table 1), and are completely missing as prey
items in the periods of higher availability of
most “appetible” preys, such as e.g.
Coleoptera Melyridae, which not by chance
are highly represented in the diet (and in the
field) during Spring.

The analysis of the dietary spectrum of
Podarcis raffonei clearly indicates that the
species - differently from several Podarcis
lizards occurring on western Mediterranean
islands (Perez-Mellado & Traverset, 1999; Van
Damme, 1999) - consumes a low amount of
plant matter (see also Luiselli et al., 2004; Lo
Cascio, 2006) and can be considered as an
opportunistic and mainly insectivorous
predator. Although our results allow to
hypothesize the occurrence of both visual and
chemical discrimination of preys by the
Aeolian wall lizard, at present we cannot say
anything about the behavioral responses to the
different kinds of prey and the chemicals
involved in prey discrimination by P. raffonei.
Further studies should thus be needed to
investigate on the ability of the species to
discriminate repellent chemicals and/or
warning odours produced by several kinds of
prey, and the senses that mediate this ability.

ACKNOWLEDGMENTS

A significant part of the field work was
performed in the frame of the Research Project
“Studio dell’erpetofauna della R.N.O. Le
Montagne delle Felci e dei Porri e di altre aree
dell’Isola di Salina”, which was funded by the
Regional Province of Messina (D.P. n. 167,
30/12/2004). The authors wish to express their
gratitude to Dr. Maria Letizia Molino, director of
the Natural Reserve of Salina Island, for her
enthusiastic support and assistance during field
work.

REFERENCES

Adamopoulou C. & Legakis A., 2002. Diet of a Lacertid
lizard ( Podarcis milensis ) in an insular dune ecosystem.
Israel Journal of Zoology, 48: 207-219.

Adamopoulou C., Valakos E.D. & Pafilis P., 1999. Summer
diet of Podarcis milensis, P. gaigeae and P erhardii
(Sauria: Lacertidae). Bonner zoologische Beitrage, 48:
275-282.

Ausden M., 1996. Invertebrates. In: Sutherland W.J. (ed.).
Ecological Census Techniques. Cambridge University
Press, Cambridge, 139-177.

Blum M.S. & Porter Woodring J., 1962. Secretion of
Benzaldehyde and Hydrogen Cyanide by the Millipede
Pachydesmus crassicutis (Wood). Science, 138: 512-
513.

Bombi P., Vignoli L., Scalera R. & Bologna M.A., 2005.
Food habits of Podarcis fdfolensis (Reptilia, Lacertidae)
on a small Mediterranean island during the dry season.
Amphibia-Reptilia, 26: 412-417.

Bonacci T., Aloise G., Brandmayr P., Zetto Brandmayr T. &
Capula M., 2008. Testing the predatory behavior of
Podarcis sicula (Reptilia: Lacertidae) towards
aposematic and non-aposematic prey. Amphibia-
Reptilia, 29: 449-453.

Calanchi N., Lo Cascio P., Lucchi F., Rossi P.L. & Tranne
C.A., 2007. Guida ai vulcani e alia natura delle Isole
Eolie. L.A.C., Firenze, 467 pp.

Capula M., 2006. Population heterogeneity and

conservation of the Aeolian wall lizard, Podarcis
raffonei. In: Corti C., Lo Cascio P. & Biaggini M. (eds.).
Mainland and Insular Lizards: A Mediterranean
Perspective. Firenze University Press, Firenze, 23-32.

Capula M. & Aloise G., in press. Extreme feeding
behaviours in the Italian wall lizard, Podarcis siculus.
Acta Herpetologica, 6.

Capula M., Chiantini S., Luiselli L. & Loy A., 2009. Size and
shape in Mediterranean insular lizards: pattern of
variation in Podarcis raffonei, P sicula and P. wagleriana

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 95

(Reptilia, Squamata: Lacertidae). Aldrovandia, 5: 217-
227.

Capula M. & Lo Cascio R, 2011. Podarcis raffonei
(Mertens, 1952). In: Corti C., Capula M., Luiselli L.,
Razzetti E. & Sindaco R. (eds.). Fauna d’ltalia. XLV.
Reptilia. Calderini - Edizioni Calderini de II Sole 24
ORE, Bologna, 401-407.

Capula M., Luiselli L., Bologna M.A. & Ceccarelli A.,
2002. The decline of Aeolian wall lizard, Podarcis
raffonei'. causes and conservation proposals. Oryx, 36:
66-72.

Capula M., Luiselli L. & Rugiero L., 1993. Comparative
ecology in sympatric Podarcis muralis and P. sicula
(Reptilia: Lacertidae) from the historical centre of
Rome: what about competition and niche segregation in
an urban habitat? Bollettino di Zoologia, 60: 287-291.

Carretero M.A., 2004. From set menu to a la carte. Linking
issues in trophic ecology of Mediterranean lizards.
Italian Journal of Zoology, 71: 121-133.

Carretero M.A., Lo Cascio R, Corti C. & Pasta S., 2010.
Sharing resources in a tiny Mediterranean island?
Comparative diets of Chalcides ocellatus and Podarcis
fdfolensis in Lampione. Bonn Zoological Bulletin, 57:
111-118.

Chao A. & Shen T.J., 2003. Nonparametric estimation of
Shannon’s index diversity when there are unseen
species in sample. Environmental and Ecological
Statistics, 10: 429-443.

Corti C. & Lo Cascio P., 2002. The Lizards of Italy and
Adjacent Areas. Chimaira Verlag, Frankfurt am Main,
165 pp.

Corti C., Capula M., Luiselli L., Razzetti E. & Sindaco R.
(eds.), 2011. Fauna dTtalia. XLV. Reptilia. Calderini -
Edizioni Calderini de II Sole 24 ORE, Bologna, XII +
869 pp.

Disney R.H.L., 1986. Assessments using invertebrates:
posing the problem. In: Ussher M.B. (ed.). Wildlife
Conservation Evaluation. Chapman & Hall, London,
271-293.

Dominguez J.F. & Salvador A., 1990. Disponibilidad y
uso de recursos troficos por Lacerta schreiberi y
Podarcis bocagei en simpatria en una localidad de la
Cordillera Cantabrica, Espana. Amphibia-Reptilia,
11: 237-246.

Duffey S.S., Blum M.S., Fales H.M., Evans S.L., Roncadori
R.W., Tiemann D.L. & Nakagawa Y., 1977. Benzoyl
cyanide and mandelonitrile benzoate in the defensive
secretions of millipedes. Journal of Chemical Ecology,
3: 101-113.

Eisner T., Alsop D., Hicks K. & Meinwald J., 1978.
Defensive secretions of millipeds. In: Bettini S. (ed.).
Arthropod Venoms. Springer, Berlin, 41-72.

Heulin B., 1986. Regime alimentaire estival et utilisation
des ressources trophiques dans trois populations de
Lacerta vivipara. Acta Oecologica, 7: 135-150.

Kabisch K. & Engelmann W.E., 1969. Zur Nahrung von
Lacerta muralis (Laurenti) in Ostbulgarien.
Zoologische Abhandlungen, 30: 89-92.

Kuwahara Y., Omura H. & Tanabe T., 2002. 2-
Nitroethenylbenzenes as natural products in millepede
defense secretions. Naturwissenschaften, 89: 308-310.

Lo Cascio R, 2006. Aspetti ecologici e problemi di
conservazione di una popolazione di Podarcis raffonei
(Mertens, 1952) (Reptilia: Lacertidae). II Naturalista
siciliano, 30: 495-521.

Lo Cascio R, 2010. Attuali conoscenze e misure di
conservazione per le popolazioni relitte dell’endemica
lucertola delle Eolie, Podarcis raffonei (Squamata
Sauria). II Naturalista siciliano, 34: 295-317.

Lo Cascio R & Navarra E., 2003. Guida naturalistica alle
Isole Eolie. La vita in un arcipelago vulcanico. L’Epos,
Palermo, 261 pp.

Lo Cascio P. & Pasta S., 2006. Preliminary data on the
biometry and the diet of a micro-insular population of
Podarcis wagleriana (Reptilia: Lacertidae). Acta
Herpetologica, 1: 147-152.

Luiselli L., 2008. Do lizard communities partition the
trophic niche? A worldwide meta-analysis using null
models. Oikos, 117: 321-330.

Luiselli L., Capula M., Corti C., Lo Cascio P. & Perez-
Mellado V., 2004. Preliminary data on the feeding
ecology of Podarcis raffonei (Reptilia, Lacertidae), a
threatened endemic lizard of the Aeolian Islands
(Mediterranean Sea). In: Perez-Mellado V., Riera N. &
Perera A. (eds.). The Biology of Lacertid Lizards.
Evolutionary and Ecological Perspectives. Institut
Menorqui d’Etudis, Mao, 223-229.

Maragou P, Valakos E.D., Giannopoulos Z., Stavropoulou A. &
Chondropoulos B., 1996. Spring aspect of feeding ecology
in Podarcis peloponnesiaca (Bibron & Bory, 1833)
(Squamata: Sauria: Lacertidae). Herpetozoa, 9: 105-110.

Perez-Mellado V. & Corti C., 1993. Dietary adaptations and
herb ivory in Lacertid lizards of the genus Podarcis from
western Mediterranean islands (Reptilia: Sauria).
Bonner zoologische Beitrage, 44: 193-220.

Perez-Mellado V. & Traverset A., 1999. Relationships
between plants and Mediterranean lizards. Natura
Croatica, 8: 275-285.

Perez-Mellado V., Perera A. & Cortazar G., 2003. La Lagartija
balear, Podarcis lilfordi (Gunther, 1884), de 1’Hla d’en
Colom, Parc Natural de s’Albufera des Grau (Menorca):
situacion actual y estado de conservacion. Butlleti
Cientific dels Parcs Naturals de les Balears, 3: 23-34.

Rugiero L., 1994. Food habits of the Ruin Lizard, Podarcis
sicula (Rafmesque-Schmaltz, 1810), from a coastal
dune in Central Italy (Squamata: Sauria: Lacertidae).
Herpetozoa, 7: 71-73.

Shannon C.E., 1948. A Mathematical Theory of

Communication. The Bell System Technical Journal,
27: 379-423, 623-656.

P. Lo Cascio & M. Capula

Sicilia A., Violani C. & Zava B., 2001. Predazione di
Podarcis sicula su Discoglossus pictus. Atti 3° Congresso
Nazionale della Societas Herpetologica Italica (Pavia, 14-
16 settembre 2000), Pianura, 13: 283-284.

Sneath P.H. & Sokal R.R., 1973. Numerical Taxonomy.
Freeman, San Francisco, 576 pp.

Sorci G., 1990. Nicchia trofica di quattro specie di
Lacertidae in Sicilia. II Naturalista siciliano, 14
(Suppl.): 83-93.

Van Damme R., 1999. Evolution of herbivory in Lacertid
Lizards: Effects of Insularity and Body Size. Journal of
Herpetology, 33: 663-674.

Biodiversity Journal, 2011, 2 (2): 97-102

Observations on the genus Athis Hi bner, [1819] and description of
a new species from Peru (Lepidoptera, Castniidae)

Roberto Vinciguerra

Via XX settembre, 64 - 90141 Palermo, Italy - e-mail: rob.vinciguerra@tiscali.it

ABSTRACT One new species of the genus Athis Hubner, [1819] from Peru (Athis pirrelloi n. sp.) is described and
illustrated. The male, the preimaginal stages and the host plant are still unknown. Some additional informations
about the genus Athis Hubner, [1819] and the congeneric species/subspecies are given.

KEY WORDS Lepidoptera, Castniidae, Athis, new species, Peru

Received 28.05.2011; accepted 15.06.2011; printed 30.06.2011

INTRODUCTION

The recent studies on Neotropical Castniidae
have provided many significant contributions to
our knowledge of their eco-ethology, systematics
and biogeography. In particular, these in-depth
studies have also contributed to extend our
knowledge of the Australian genus Synemon
Doubleday, 1846, with twenty new specific
entities currently being described (Gonzalez et
al., 2010), while the data available on the
distribution and natural history of the only Asian
genus ( Tascinia Westwood, 1877), made up of
four species, remain scant.

The majority of the studies have concerned
mainly the distribution of the Neotropical taxa,
especially in Venezuela (Gonzalez, 1998, 1999,
2003; Gonzalez & Romero, 1997; Gonzalez et
al., 2006), Trinidad and Tobago (Gonzalez &
Cock, 2004), Colombia (Gonzalez & Salazar,
2003), Mexico (Miller, 2000; Gonzalez et al.,
2008), Peru (Vinciguerra & Racheli, 2006;
Vinciguerra, 2008a; 2008b, 2008c), Ecuador
(Racheli & Vinciguerra, 2006; Vinciguerra,
2010) and Hispaniola (Vinciguerra, 2008a).

A further contribution has been the description
of two interesting endemisms: Insigniocastnia
taisae Miller, 2007 (Ecuador, Esmeraldas), and
Zegara polymorpha Miller, 2008, currently

known only in Colombia (Otanche). The latter
displays a marked polymorphism and is
“involved” in complex mimetic chains with
Heliconius wallacei, the Danaids of the Lycorea
genus and the heterocera of the Pericopis and
Dysschema genera ( D . unifasciata , bivittata,
formossimia, and joiceyi ) (Miller, 2008).

Frequently in the Castniid, in fact, the imago is
characterized by bright or aposematic (rarely
cryptic) coloration and “mimics” the Lepidoptera
of the Papilionidae, Danaidae, Ithomiidae,
Hesperiidae, Lycaenidae and Pericopidae families,
relationships that would deserve further analyses.

However, the difficulty in locating the
Castniid makes it hard to carry out systematic
and faunistic studies on them: owing to the
behaviours tied to the eco-ethology of the imago
(brief flying activity, extreme localization and
territoriality, adults only sporadically
approaching the ground), the Castniid are in fact
heterocera that are notoriously “under-
represented” in the museum and private
collections (Lamas, 1995; Gonzalez, 1999;
Vinciguerra & Racheli, 2006).

Commenting their capture, Strand wrote (see
Seitz, 1913): “ Dans la plupart des cas la capture
des Castnies comme papillon est egalem assez
difficile; c ’est sur les fleurs qu ’on la prend le plus
facilement. Sur des arbres en fleurs j ’ai pris assez

R. VlNCIGUERRA

souvent de bons expl. C. pallasia et quelques
decussata. Une fois dans le filet I’insecte se
demene si energiquement que c’est bien rare
qu ’on russi a rapporter tin expl. immacule

The Athis Hiibner, [1819] genus (Figs. 1-10)
which the species currently being described is
ascribable to includes, according to Lamas (1995),
approximately fourteen - fifteen taxa, making it
the largest member of the Castniidae family, which
includes a total of eighty known species divided
into thirty genera (Gonzalez et al., 2010). The
distribution is Neotropical (Mexico, Bolivia,
Brazil, Peru, Panama, Venezuela and Trinidad)
with three significant endemisms present in the
Caraibic area, including Athis pinchoni Pierre,
2003 (Martinica), and Athis axaqua Femandez-
Yepez, 1992 (Margarita Island, Venezuela).

In the Island of Cuba, Athis Hiibner, [1819],
appears to be absent. The Athis inca orizabensis
(Strand, 1913), specimens preserved at the Field
Museum of Natural History (Chicago) as part of
the Herman Strecker collection, and labelled as
originating from Cuba, were actually introduced
accidentally from Mexico with the introduction
of vegetable species containing chrysalides
(Gonzalez et al., 2010).

The Athis imago has triangular-shaped
forewings, with two (or three) hyaline ocelli
located in the sub-apical area, the apex is pointed
or rounded, while the hindwings are brightly-
coloured, in contrast with the fore wings, which
are, usually, cryptic or dark brown (Figs. 4-10).

The adults appear to have selectively diurnal
habits.

From a morphological point of view, the most
similar genera are the Insigniocastnia Miller,
2007 and Hista Oiticica, 1955. The latter has
been the subject of a recent systematic review
(Moraes et al., 2010), and includes two taxa:
Hista fabricii (Swainson, 1823), and H. hegemon
(Kollar, 1839). The Hista species, in fact, were
originally included by Houlbert in the Athis
genus and subsequently appended to the Hista
genus by Oiticica (1955), the founder of the
genus, who had christened it Hista using the
anagram of Athis , expressly to highlight the
similarities between the two.

Little is known about the eco-ethology of
Athis and the larval stages are virtually unknown,
as are the host plants on which the worms evolve,
albeit two recent studies have shed light on its

distribution and systematic: the first by Gonzalez
(2004) and concerning Venezuela, and the
second on the inca “group” (Miller, 1972).

Gonzalez et al. (2008) have also analyzed a
probable hybrid between Athis inca orizabensis
(Strand, 1913) and Athis inca inca (Walker,
1854), proof of the hybridization, occurring in
nature, of the two sub-specific entities.

New research has been carried out on the
distribution of Athis fuscorubra (Houlbert, 1917)
(Fig. 9), found in the Island of Trinidad (Gonzalez
& Cock, 2004) and of Athis palatinus staudingeri
(Vinciguerra & Gonzalez, 2011 currently in press)
discovered in Costa Rica and previously known to
exist only in Panama. The taxonomic rank of the
latter is unclear since Lamas (1995) considers it a
sub-specific entity of A. palatinus , while Miller
(1995), a valid species. The status of Athis
thysanete (Dyar, 1912) (Fig. 8), endemic to Mexico
and only seldomly captured, is equally uncertain.

Owing to some considerable morphological
differences, this taxon is presumably not ascribable
to Athis (Gonzalez, personal communication).

Athis pirrelloi n. sp.

Examined material. Holotypus female
(Figs. 1, 2): Peru, Huanuco, Cueva de las Pavas,
21. III. 1998, 650 m, local collector legit, in the
author’s collection.

Description of the holotypus. Head and
thorax, in the dorsal part, are light brown in colour
and light yellow in the ventral part. The antennae
are dark brown. Abdomen: in the dorsal part, grey-
brown in the first three urites, then yellow-ochre;
in the ventral part extremely light yellow. Upper
surface. Forewings: Length of the forewing: 52
mm, triangular-shaped wings, straight margin and
rounded apex. The cost, in proximity of the apical
area, is clearly characterized by a “depression”
rendering the aforementioned area considerably
elongated. Presence of two hyaline ocelli (one of
which is larger than the other), whose boundaries
are marked in black, and that are located in the sub-
apical area. General coloration: light brown,
slightly darker in proximity of the costal area (on
the internal margin). Two ocelli (joined) are
located: one in the discal area and the other in the
costal area. Postdiscal band (wavy): scarcely
visible, with four darker spots parallel to the edge.
Upper surface. Hindwings: dark brown basal area;

Observations on the genus Athis Hiibner, [1819] and description of a new species from Peru (Lepidoptera, Castniidae)

Figure 1. Athis pirrelloi holotypus female (recto): Peru, Huanuco, Cueva de las Pavas.
Figure 2. Athis pirrelloi holotypus female (verso): Peru, Huanuco, Cueva de las Pavas.

100

R. VlNCIGUERRA

Figure 3. A this rutila female: Pern, Tingo Maria, Huanuco.

Figure 4. Athis flavimaculata male: Mexico, Jalisco, Tuxcacuesco.

Figure 5. A this palatinus staudingeri male: Costa Rica, Corcovado.

Figure 6. A this palatinus fermginosa female: Peru, Tingo Maria, Huanuco.

extremely light yellow discal and postdiscal areas,
marginal and costal areas orange-colored. Eight
ocelli (the first two orange and the others dark
brown) run parallel to the wing margin.

Lower surface. Forewings: yellow-ochre
general coloration, darker compared to the upper
surface, one ocellus is located in the discal area
and another extends towards the costal area. On
the lower surface, the postdiscal band is not
visible. Hindwings: Uniform light yellow
coloration. The eight ocelli, located on the upper
surface, are barely discernible on the lower
surface, except for the last two, which are located
in proximity of the anal angle.

Variability. Male and other females are
unknown, at present.

ETIMOLOGY. The species is dedicated to
Roberto Pirrello (Trapani, December 24 th , 1963),
eminent surgeon, a Plastic and Reconstructive
Surgery specialist, and a researcher and lecturer at
the Faculty of Medicine and Surgery of the
University of Palermo.

Distribution and ecology. Found only in
its typical locality. The preimaginal stages and
the host plant are still unknown.

Comparative notes. Athis pirrelloi n. sp.
shares morphological and wing pattern similarities
with the species of the palatinus “group” (Figs. 5-6).
Clear analogies can be established with Athis
palatinus staudingeri (Dmce, 1896) (Panama and

Observations on the genus Athis Hiibner, [1819] and description of a new species from Peru (Lepidoptera, Castniidae)

101

Figure 7. A this superba female: Peru, Tingo Maria, Huanuco.
Figure 8. Athis thysanete male: Mexico, Puebla, Teuacan.

Figure 9. Athis fuscorubra male: Pem, Satipo, Prov. Junin.
Figure 10. A this therapon male: Brazil, Santa Catarina, Joinville.

Costa Rica), which it differentiates itself from in
terms of colouring and forewing shape.

The cost of A. pirrelloi n. sp., in proximity of
the apical area, is clearly characterized by a
“depression” considerably elongated, a pecu-
liarity distinguishing it from all the other
congeneric species and relating it to the female
Athis rutila (Felder, 1874) (Fig. 3), which
displays the same morphological characteristic.

In contrast with the other congeneric taxa,
Athis pirrelloi has a considerably “elongated”
forewing shape, a peculiarity it “shares” with
Athis therapon (Kollar, 1839) (Fig. 10).

Kollar (1839) highlighted said peculiarity in
the description of the therapon holotype, writing:
'Alls superioribus elongatis, supra flavescenti -

rufis [ ] ”, and also: “Alae superiores baud

consuetae plurimarum Castniarum formae, sed
magis elongatae ...”.

There are no other taxa with which to
establish further comparisons, however, the hairs
of the forewings and the study of the wing
venation lead us to classify the species under the
aforementioned genus.

CONCLUSIONS

Athis pirrelloi constitutes an important
naturalistic find worthy of further in-depth
studies, which we intend to carry out when other
specimens will be made available (extraction of
DNA sequences, analysis of the genital

102

R. VlNCIGUERRA

apparatus, study of the biogeographical
distribution and of the variability of the species).

The holotype described and depicted below,
and the specimens of the Athis genus shown,
derive entirely from the author’s collection.

ACKNOWLEDGEMENTS

I am grateful to: Michael Buche (Tenerife) for
helping me find the material examined; to J. M.
Gonzalez (Texas) and to the staff of the Natural
History Museum (former British Museum, London)
for sending me the bibliographical material.

REFERENCES

Gonzalez J.M., 1998. Castniinae (Lepidoptera: Castniidae)
de Venezuela. IV: El genero Haemonides. Boletln del
Centro de Investigaciones Biologicas Universidad del
Zulia, 32: 195-201.

Gonzalez J.M., 1999. Castniinae (Lepidoptera: Castniidae)
from Venezuela. Ill: Genera represented by only one
known species. Diagnosis and comments. Ciencia, 7:
229-235.

Gonzalez J.M., 2003. Castniinae (Lepidoptera: Castniidae)
from Venezuela. V: Castnia Labricius and Telchin
Hiibner. Boletin del Centro de Investigaciones
Biologicas Universidad del Zulia, 37: 191-201.
Gonzalez J.M., 2004. Castniinae (Lepidoptera: Castniidae)
from Venezuela. VI. The genus Athis. Diagnosis and
comments. Caribbean Journal of Science, 40: 408-413.
Gonzalez J.M. & Romero R, 1997. Confirmacion de la
presencia de Haemonides cronis (Cramer) (Lepidoptera:
Castniidae) en el Parque Nacional “Henri Pittier”.
Boletin de Entomologia Venezolana, 12: 119.

Gonzalez J.M. & Salazar J. A., 2003. Adicion a la lista de
castnidos (Lepidoptera: Castniidae: Castniinae)
conocidos de Colombia. Boletin Cientifico. Centro de
Museos. Museo de Historia Natural Universidad de
Caldas, 7: 47-56.

Gonzalez J.M. & Cock M.J.W., 2004. A sinopsis of the
Castniidae (Lepidoptera) of Trinidad and Tobago.
Zootaxa, 762: 1-19.

Gonzalez J.M, Ayala J.M. & Alnaudez J.L., 2006. Notes on
Castniinae (Lepidoptera: Castniidae) of Margarita
Island Venezuela. Boletin del Centro de Investigaciones
Biologicas Universidad del Zulia, 40: 347-355.
Gonzalez J.M., Hemandez-Baz R & Vinciguerra R., 2008.
Notes on some Athis inca ssp. collected in Mexico
(Lepidoptera: Castniidae). Shilap Revista de
Lepidopterologia, 36: 473-476.

Gonzalez J.M., Boone G.H., Brilmyer G.M. & Le D.,
2010. The Gigant Butterfly-moths of the Lield Museum
of Natural History, Chicago, with notes on the Herman
Streclcer collection (Lepidoptera: Castniidae). Shilap
Revista de Lepidopterologia, 38: 385-409.

Kollar V., 1839. LepidopterommBrasiliae Species Novae. Annalen
des Wiener Museums der Naturgeschichte, 2: 215-218.

Lamas G., 1995. A critical review of J. Y. Miller’s Checklist
of the Neotropical Castniidae (Lepidoptera). Revista
Peruana de Entomologia, 37: 73-87.

Miller J.Y., 1972. Review of the Central American Castnia
inca complex (Castniidae). Bulletin of the Allyn
Museum, 6: 1-3.

Miller J.Y., 1995. Castniidae. In: Heppner, J.B. (Ed.),
Checklist: Part 2. Hyblaeoidea-Pyraloidea-Tortricoidea.
Atlas of Neotropical Lepidoptera. Association for
Neotropical Lepidoptera/Scientific Publishers,
Gainesville, pp. 133-137, 176-177.

Miller J.Y., 2000. Castniidae (Lepidoptera). In: B.J.
Llorente, J.M. Gonzalez & N. Papavero (Eds.).
Biodiversidad, taxonomia y biogeografia de artropodos
de Mexico: Hacia una sintesis de su conocimiento, 2:
527-531.

Miller J.Y., 2008. Studies in the Castniidae. V. Description
of a new species of Zegara. Bullettin of the Allyn
Museum, 160: 1-13.

Moraes S.S., Duarte M., & Gonzalez J. M., 2010. Revision
of Hista Oiticica (Lepidoptera: Castniidae) and
discussion on the validity of its subspecies. Zootaxa,
2421: 1-27.

Oiticica J., 1955. Revisao dos nomes genericos sul-
americanos da subfamilia Castniinae (Lepidoptera
Castniidae). Re vista Brasileira de Entomologia, 3, 137-
167.

Racheli L. & Vinciguerra R., 2006. Notes on three Castniid
species from Ecuador (Lepidoptera, Castniidae).
Entomologische Zeitschrift, 116: 169-170.

Strand E., 1913. Gattung: Castnia. In: Seitz, A. (Ed.). Die
Gross Schmetterlinge der Erde 6. Vol 1. A. Kemen,
Stuttgart, pp. 7-17.

Vinciguerra R. & Racheli L., 2006. Note sulla distribuzione
di alcuni Castnidi in Peru (Lepidoptera, Castniidae),
Berichte des Kreises Numberger Entomologen V, 22:
27-39.

Vinciguerra R., 2008a. Osservazioni su Ircila hecate
(Herrich-Schaffer, [1854]) (Lepidoptera: Castniidae).
Shilap Revista de Lepidopterologia, 36, 205-208.

Vinciguerra R., 2008b. Osservazioni su alcuni taxa dei
generi: Corybantes Hiibner, [1819], Athis Hiibner,
[1819], Zegara Oiticica, 1955, Mirocastnia Miller, 1980
e Insigniocastnia Miller, 2007 (Lepidoptera:
Castniidae). Shilap Revista de Lepidopterologia, 36:
491-499.

Vinciguerra R., 2008c. Descrizione della femmina di
Eupalamides preissi (Staudinger, 1899) (Lepidoptera,
Castniidae). Shilap Revista de Lepidopterologia, 36:
487-490.

Vinciguerra R., 2010. Osservazioni sulla distribuzione di
Divana diva hoppi (Herinh, 1923) (Lepidoptera:
Castniidae). Shilap Re vista de Lepidopterologia, 38:
379-383.

Vinciguerra R. & Gonzalez J.M., 2011. Observations on
distribution of Athis palatinus staudingeri (Druce,
1896) (Lepidoptera: Castniidae). Shilap Revista de
Lepidopterologia, in press.

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Texts

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "Biodiversity journal"

See other formats